Description :
From Genome Similarity Track
Location :
Scaffold_2838:1058- 2463
Transcript NameFunction/comments
Phypl_g15430reverse transcriptase

Sequence
1405 bases(100 bases per row)
ATATCCACGTCATTCTTCTTGATAATCACCACGATGGGCGAGGTCCACGGGGATGTGGAGTGTCGGATTATCTTCGCCGACAACAGTCCCTGCAAGAGAT
CGGACACTTTCTCACGATAGCGGGGTGAGATCTTTCGTACGCGTTGAGCTATCGGTTTGGCATCTCCGGCATCGATGTCACACACAACTCCAACTGCAGC
GGGGGGTAGAGCATTGCCTTTGCTGATCAGCAAGTGTCGCTGTTGCCAGATGATACCCCGCAGTTTGCAGATCTCTTCCTTCGTGTTCGTATCTGGATCT
ACGACCTGTAGATTTTCGATCCGCACCTCCACCGTGCCAGATGTCACTTCTGGAAGTATGGCTAGCTCGCCTTCTACTTCTTCTGCATGTAGCatgccgc
cgtcgtggtggcaGCGTTCGAGCTTCCTAGCGCAGTTGTCTGGTCGTTCCGGTGGTTCACCGCCAGATTGCACGCTGGAGACCGCTCCTGGAGACACCGC
TGCGAGAGGCGGGGCACAATGATTGGTAGTCCGGTCGGACGCCGTTGGTCCACTAGGTCCTTCCGGGCCCTCGTCAACGGGGTTGAGCTTGTGGTGTAGC
GGGATCGGCCAAAACCTTGTTAAGGCCAGATCGAGCTTCCCAACANGATCTGCTGAACTTGTTatcaccttgtgtacccgtcggtgggCCTGATCTGCTC
TCTCGGGACTCCGAAGGATGCAGTGGTGAAGCGTAGAACGTCTTGCGTGACGCGGGGAggggtggagcagcgcagaagtcttcgctctgcgtcCGAGTTG
TTGTTCCTGATCCGAAGCGAGTCGATCGAGCTCCGATCAGGAGGCCTGGACTTGATCCGAGGCCGGGTGCCTTTAAGGGTATGAGCCTTCCtttccttga
gctgcttgccgcttcctgtAGCGGGATCTTGCGAGTTGAGAGCCGAAGCGATCGCCGGTCAAGCAATGAATACCGGCCGACCAAGATGCGTTCTTGAACA
GTAGATCACTAGTTTGGGGAAGGATCGGCCAATATATTATCCAAAACTTACACCACAACACTAGATCTGCTACTCTTGACTGGCCAACACCTTGTAGAGC
CAATGTAGTTCCTGTTCCTTGGTATCTGGAAGTCGCTTGCGTAGTCCAATGCAAATTCGAGTCTGATTGTTGTTATCCCTATCTNCGTCGATCCCGATCG
AGAGCCGATCGCGATCGCTCGCAATCCGTAGATCTTGATCAAGGGTCGGTCGTGATCGTTCGTGATCCGTCGGCTGTTGGCAGGGCTTAGTCCTCACTCC
CATTGCTTCCGCGCAAGCATTGGGTCTCCTCTCAGGCCCCGTTTCTACTTGCGTCCCCTGATGTCGCCAGATTATAACAGATTACCGCCGGATCACCCAT
CATCC