Description :
From Genome Similarity Track
Location :
Scaffold_1439:1058- 2095
Sequence
1037 bases(100 bases per row)
TCAGTGATGAGGCAATTCGCCCCCTTCGACTTATCATGGTACTCTCCGTTGAATCAGCTGAGCTTCTCCCAGAGActctctccatcatcttcgcttcctt
cgcagaaaaaagaagcgcaagatcaTCCTGGACGATGTCCGTGAGTAGCTTCAGTTTGCTGTCTCAGAACCATACTCCAACGAAGCCACCGCTGTCGGTG
ACACTGCtaacgatgaagatgacgaacaGGAGTGGAGCACCGATGCGAACACTGAAGCCCAGCCACTGCACTTTGTCCACCAACTTCTCGACAGTAAACG
GGAGGGGCACAAGACGTACTTCCTCACTGACTGGGAGCCGACTTGAGAGCCGTACAAGAACCTACCGATGACGGTGATTGCTCGCTTTCGTAAAGAACGT
AGAGCCCTTGTTCGTCGAACCTACATCGAACATGAGGCAACGGAAGACAACTCGCTAAACATGACAGAGGGATAATACACATGAGAAGGTTTGgactgca
aaatattttctATTACACGATTAAGGAGAGAAAGACACTCGAGAGAGATACTCGCACAACAATGTTAACCACCAGACACAGAACACAAAGCTTAGCCTCC
TTGCGGAACAGCAATGTTAACCTCTGAGCCAAGCACACAAAGTTTAACGCAAGAACGCTCCCATGAGcgcagcaatagcaacaagaagcacataCAAGAC
ATACACATATAAACACACTGATGCTCTTAGCGAATCAACACTAGTGAGGCCCAGATCCGACCATAGAAGAGAGGGTGCCTTGTGCTCTACCGTGAAAAAA
CTCGAATGGCAAGGTGTTCAGCTTGTCGGTTGCTCTGAATCACTGGATCGATCATTGGCCTGGTCCAATGATTTCTATTTTTACATCATGGCGTAACTCC
AGCTTATTTACAGTAATGACAACTTGTAAAAAGAAGGGTTTTACCAACGTGCTCTTTTTAGTGGCCCCCAATTTCTGTGCCCAGCCCTCATTTCTCAATA
TGCCGCACGGAGAGTACATGCCTCTATCGCTTAAAAA