Description :
From Genome Similarity Track
Location :
Scaffold_1:105779- 108944
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-1.0Sodium/hydrogen exchanger

Sequence
3165 bases(100 bases per row)
CGCTGCAGCGCGCGCATGAGGCCGGACTCGACCCGCAGATCCTGTTCTTCGGCCTGCTGCCGCCGATCATCCTCGAGGCGGGGTTCAACACGCAGCGCAA
GGGGTTCTTCTCCAACTTTGCCGCCATCCTGTCGCTCGCGATCGTCGGCACCTTGATCGCCACGTTCGCCACGGGCGGCATCCTCCTGGCGCTCGGCGCC
ATCGGACTCATCCCGCAGCTCACGTCGGCCGAAGCCTTCCTCTTCGGCGCGCTGCTGTCGGCGATCGACCCGGTCGCGACACTGCTCGTCTTCAAGAAGT
GCAAGGCTCCGCCTTTGCTCTTCAACCTCGTGTTCGGAGAGAGCGTGCTCAACGACGCCGTCGGTACGCCTCCGAGTCCTGTGGGTTTAGACCTGACGCA
GTGTTAACAACCTTGATTATCGTGTGTCGCGTGCAGCAATCGTGTTGTTCACGCTGTTCCAGAACCTGATCTCGACAGGCAAGTCGGAGCTGGACTTGCT
GTCGACCTGCAACATGATGGTGCAGCTGATCGGCATCATGGTGGGGTCGATCGCGCTGGCCGGCGCCATCTGCTACTCGTCCGCGTACCTGCTGCGGCAC
TCAGACCCGTCGCTGCGAGACCACCCCGTGTACGAGATCTCCATCATCCTGCTCTCATCGTACGCGAGCTACCTGGCGGCCGATCTGATCCAGCTCAGCG
GCATCCTGGCCGTCTTCTTCAGTGGCGTCTTCATTCGCCACTACCACATGTACAACATCTCGAAGGGGAGCGCGTACGCCTTCACGCAACTGCTCGAGAC
CATCGCGTTCCTCGCCGAGAACTTCATCTACCTCTACCTCGGCATCAGCTTGATGGCGTACCGCCTGTCGTTCGTGTGGAACTGGCCGTTCATCCTCGCC
ACGTTCGCCGCCTGCCTCATCGCGCGCGGGTTCAACACCTTCCCGTTGTGCAGCCTCGCCAACCTCGGCCGCTCGCCGCGGAGCAAGATCCCGCTGTCGC
ACATGGTCGTCATCTGGTTCTCCGGACTTCGTGGGGCTATTGCCTTCGCGCTGGCGCTCAACGTGTACACGACCGACCCGAGCCACGCAGCTATCATGAA
GAGCACGACGTTGTTAATCGTGCTGTTCACTACGGTGTTCCTCGGGATGACCACTGGTCCACTGCTGGACTCGCTGAGTCTGAGCGGCATCAGCGCCAAG
ACGGGCGAGGTCAACACCAGCGCGAGCGAGGCAGAGACCCAGCCGCTGCTTCCCCCGCCGCTCTCGACCCCTCCAGGCTCCGTCAGCGTGCACACTGCGT
GGGTCGACATCGACGAGAAGTACCTGAAGCCGGTGTTCGGTGGTCGACCACGTTCCCAAAGCGATTCGGGTGTCCCAGCAGCGTGGCAGCCAAGTGCGTA
GGTAGCGGGAGCTCGACAAGGTTGTCGCAGCAACGGTAGTGCAGACTGTGTAGAGGGACGACCGAGCATCGGTTGCGATGTAGTCGACCAGTTTGAGCGG
GGCCGCGTCCGGATACGGCGTGACGGCGCTCGTTGTGTGAAGTGTGGAGTGAATACGCGACTGTTTCTTCAACGAGCGAGCTTGTCTCCCTGTCTCCTCC
GCTCGCCGTGTCGCGCAGCTCGACGCCAACGGTGGCATCCACTTTTTTTTTTGCGAGACTGACCATGAGCATCGGCGTGGTGGAAGTGGAGCGAGCGCAG
AAGCGGTGGGCTGGCGGCGAGCTGCTGCTGTATGCGGCCATGCAGCTGGCGCTGGTCAGCGTCGCGTACAAGATCGACCGCCGGCGCAAGGTGCCTCTCG
TGGCGACGTCGTCCTGGGCCATTCTCCTCGGCTTGGCGGTGCGCGCTGTCGACTCGTTCTCGATGTATGCGACTTCTCTTCTGATGTTTTCCTGGTTGAT
TCTGACAGTGTGGCGCTGTGCTCGCGCGCTTGTCCAAGCGGGTAAGTTTGATCCTTGCTGCTCTTTGTTCGATGTTCATACCAACCGAGCAATGCATCAT
CTCCACAGAGAGTCGACGAAGCTGGCCTCGACCCTCAGATACTCTTCTTCGGCTTGCTGCCGCCGATCATCTTCGAGGCGGGGATCAACACGCAGCGCAA
GGGGTTCTTCTCCAACATCGTGGCCATCCTGCTGCTCGCCGTGGCCGGGACGCTGATCGCCGCGTTCGCGACTGGCGGCGTGCTGATCTGGCTGGGCAGT
CTGAACGTCATCCCAGCGCTGACGGCGGCCGAGGCGTTCATGTTCGGAGCGCTCATCTCGGCTGTGGACCCGGTGACCACTCTTCTCGTCCTGAAGAAAT
GCCGCGCGCCGCCTTTGCTGTTCAACCTCGTGTTCGGTGAAAGCGTCCTCAACGACGCAGCTGGTAAGAGACACTTCACTACATTTGACTGCATCCGCAG
CTGCTTGCTCATGCCTCGACCATATCTGCCGCAGCGATCGTGCTGTTCACGCTATTTCAGCAGGTGGCGGCGACGCCGGACGCTCAGGTGGACGCATGGA
CAGTCGGGTGGCTGTCGCTGAGACTCGTGTTCATCATCGTGGGTTCGGTGCTGCTGTCGGGAGCCATCTGCTACTCGTCCGCCTACCTGCTGCACCACGC
AGACCCGGCGCTGCGACAGCACCCAACGTACGAGATCTCGACGCTGCTGCTGTCCGCATACGCGAGCTACCTGGCGGCCGAGCTGGTGGATCTCAGCGGC
ATCCTAGCGGTCTTTTTCAGCGGTGTGTTCATCCGCCACTACCACGCGTACAACGTGTCCAAGGCGAGCGCGTTCGCGTTCAAGCACCTGCTCGCCACGC
TCGCCTTCCTCGCCGAGAACTTCATCTACCTCTACCTCGGCATCAGCTTGATGGCGTACCGCCTGTCGTTCGTGTGGAACTGGCCGTTCATCCTCGCCAG
CTTCGGCGCGTGTCTGCTGGCGCGCGCGCTCAACGTCTTCCCGCTCTGCGCGTTCGCGAACCTCTGGCGGTCGGCGCGCCACCAGATCCCGGTGAAGTAC
ATGGGAGTCATCTGGTTCTCGGGACTGCGCGGCGCCGTGGCGTTCGCGCTGGTGCTGAACGCCGAGACGATGAACCCTACTCACGCGGCCATGCTCAAGA
GCTCGACGATCTTCAACGTGCTGGTCACGACCATGGTGTTCGGCGCGCTTGTCGGGCCATCGCTG