Description :
From Genome Similarity Track
Location :
Scaffold_5:10577- 19582
Transcript NameFunction/comments
Phyta_totarag369hypothetical protein

Sequence
9005 bases(100 bases per row)
CAGTTCTTCCGTCGGTTGTGTATGAAAATTTGGATGGCGACAGAACGGCAACTCTAGTGACTCCGAGCGCAGGAGTGCTCATGGCCCACGTGAACTACAG
AACGGTATGCCGCCCAATTGGTGTTggtcaacaacaacatctGGACACTAACGATTCACGTGCCGCTGTCTCCACTTCCAGGATTCGCGATACTACACCG
AGAATGTGCTGGAATCCAGACTCAATTATCCGAGTACGTTGGTAGAGCAGAGTATCATTACACCACCAAATTTCTAGGCAATGAGCTGATGAATTGTGAC
GTTTCACCTGAAGCCTCCCTGAGTCCGTACGCGAAAATGTCGTATGCATCTAAGCCCATGTCAACAACGGCATACAAAGCAGGGCAAGGAGCAACTTTTC
AAAAAGACTTTGACGCCGCTGCGGCTCCTGCGGAAAGCGACGGATTCTGCGAGCGAGAGTTATCTGCACTGGGGCCTTTATTGCACACTCAAAGTGATTT
ATGCGGCAGATTCAAGCAGGTGGACACGAACGTGGGGTTTCTGCTCCAGGTGGAACTTGTGGAGCCTAGTCCTGTCGCTACAAGCTGGTCGTGGTATCTA
GGATTGCCTTTTCGACTCGGCAATGGTGCCGTGGTAGTTCTGGATGGAGTTGTTGTGCAAGACTTGATGGGAAAAACAGGTTATTGGAAAGGTGTTCTGT
CTAAAACTACCCAAGTGGACATGAAAATCACACCTGGCTTTCATGTGCTGAAAATTTATGGGCTCTCGACCAAGTTTGAAACGTCAAGCGTATACTTCAG
TCGAGAGGGATCTACACCAGCAGTTGCTTCTATTTCTGCCATTGTTACGGAGCTAACAAAATGGTTGCCATTCGTCGCTCCTGATTTAACGATATCAGCC
ACGCTTACCACTGAACAAACAAATAAAGCTAGCAGTGTCGGGAGGGGAGTTTCCGTTTTACAGTTCCAAAATGCTCCTGTGGATGGACGGTTCGCACTGC
ACCTAGGATCGGTGTCAACAACAGACGCACAATGCGCCAAGTCGAATACCTCATCGCTAGTCTCGTTTTCCTTTCTACCAACCACCGCTTGGTCTAATAC
CAGGGCGACTCAAGTAGCTTTCCCAACAGCGATCACCTCACAGTGGAGTGCGGTACCTGGATTAACCTTTGCTTTGCCGTATACATCAAGTGGAGTTTTG
CTATGCTCGTTTACTGGAAGATTTTTTCTGGACAAGAGCACCGTTAAGACTTTCCGCCTAGATCTCGGATTTGGACCAATCTCTGCACCGCCAGTGTCGC
AATTTCGCTTGGACGAAACATTCCTTGATCCATCTGGAGTACCACTTGACTTCTCCTACTTTGCTAGCGTTTCGACGGCAAGTTCGTTGAATATTTCTCT
CAGTTATCAGTATCAAGGAACGAAAACAGGAAAAATCATTGGCGGCAGAACTACAGCGGTATACATTCCAGGGGCTGCACTCACCACGGACACGTTTACT
GATAAAACGGTGATCTTGACAGCCACACTCTTCTCGAAATCAGTAACGCTTGCTTCCTCAAGTACACTAGTCATCTGCGTTGCTGGTGTTATTTGTCGCA
ATTCGGCCACGGAGACTTTCCGTGCGCGAATATCAAAAAATGGTGATCTGCTTTTCGATGGAGACTTCTCTTCAGTCTCCGGTACAGCAGCGAATGGAAC
CTGCGAGCCTTTAGTAATGCATTCTGTCGTGGACGCAGTGGCTGGTTCTCACACAATTGCAATTGATACAAAAACGTCAACAAGTGCAGGGTTTCAACTA
AAAGGAGTACAATTGCAGATTGCCACCATAGAGAGAGGTGCATTGCTATCTCAGGAACTATGTCAATCACGTTGCACACGACACGGCCTCTGTCGATTAG
GTGTGTACAACACTGTGACGAACACATGCAACCTCTATATGCTTCGCAACACATCAACTTTGGCAACAGATTCGACACGGTCGACTTACGTGCGAAATCA
AGAATCATCCATTTCGGAAAACGCGTGGACAATTCTACACAACACCAAGTGGTCTCTCAGCCAGAATGTATCCATGCAGGCGCAATGCAAAGGCGACACG
TGTGGAACCAGTGTGTGCTCTGAAACTTACACGTTAAAAGATCGTTGCCGGTGCATTTGCCAATCTAGCAACAATTGTGTTGGCTTTACCAAGACAGATG
GAACGTGCTATGCGATCACAGTAGCTGATCTCCGACAAAACATACAATCAGGCACATACAACGCTTCAGGTGGAAGCACGGTTCACCTGAATATGCCTCA
GACTTGCCATGCAATCAAGGCTGACGCGTCCAATGCAACGAGTGGAAGGTATGCTATTGCTACTACTACAGGAATTTTTGATGCATTTTGCAACATGGCG
GCTGATAGCGGCGAAGGCTATACGATTGTCCCGTGTGATATGGGTACCAGCGATATCGATTGCCGAAGCAGCATTGGTCCGAAAGACAGTGACTCCTGCA
AGGCAATGGGCCTCCGGCAGGTTGTACCGCGCTCAGCAGGGCATCTAGTAGCTATGCACCGGAAGTATGGTTCATTATTTTTCTCGACTGTTCCTGGAGT
AACGAATGCCTACATTGGTGATACTGTCGATTTACCAAGTGACGAAGATACTGTGCTAGATTGGACAGCAATTGATGGTGGAAAGTGGTGGCTACGTGAT
AACGGAAGCAGCTGTGATGTCGTCTCTCCTGCAAATGCACCAGACGAAAGAAGATGGCTTGGGATGCATTCTTTGCTCAACGGACAAAACACCTTAGACG
GATTGGGGTTAAGTTTCGATCCTCGTGGTTTGGTGACAACAAAATATTTGTGCTCAACAAACGATATAAGTCCTTCAACATCGTGGAGCTTCGCTCTTCA
AGACTCCTTCATTGGTAGCGGCGATGATAATCTGTGGGTAACGTCGTGGAGTGGTACAGATAAATGGTATCAACTTTGCCAAGGAATCGTGATTCTCGGT
GGCAAAGCATTCGCGCGGGCCGGCTCTTACGTTAATAAAACAGTGGCTCAGATCAATAAGAGTGATAAACCTACGAACGTGCGCGTCAAATTTACGTACT
ACTTTGTGTTCGACCCCCTCTACTGGATCACACTTCTTCTCAAAAGCTCTGAGCCAAAGACTATTCGTGTTTTTCTCGGTTCTCAACTGGttcgacaagt
tcaagttgACACATCGGTGACGTATGCATGCTACGGACAGAGCTCTACTTCTGCTCAACAAGCGTACTTCTACCGAGGGGGGGAGCGTTTTGTGGTGAGA
GGCTTCAGCGGAAACGCGACTCAACTTCGGTTTGAAATTGATTTTGGATCCTTGAACATAAGTGCTTTTGGGATCGACGAGGTATCAATGGAGGTAGAAT
CCTCTTTCAAAACGCCGCTAGGACTATCGATGGCAACTCCAGCAACGGCGTGCATGCATCTGAAGAATGAGCGATTATCAAATGGGGACCCGAATCCAGA
CGGCCAGTACTATATTCAGTTTGACCCTAGCGTTGATCCTGTAAATCTCCCTTGCTCAGATGGCTGGATAGTTGCACAGCGTCGCATTAACGGAAAAACG
ATATTCAATCGCAATTGGGTTGAATATCGCGATGGATTTGGCTTGGGTTCATCCAGTGAGTGGTGGATTGGAAACAATATTCTTGCTGCCATTACAGCAC
GAGCTACTGAGGCAATGATCGTGTTATCAAAAGATTATAAGTCTCAAGTTGCGTTCTACAGTGACTTCCGAGTGTCTAGTGAAAGCGAAAAATATCTCCT
GACAGTACGAGGATACAACGCGACAGCAAGTTATGCCACTGATGCCTTAAGTTCCCTTTCGAATACGTATTTCAGCACGCCAGACCAGGATAATGACTTG
TCCGCGAGCCAAAATTGTGCCAAGAAAAGCCGGAGCGGGTTCTGGTATGCCGACTGCCTCAGCTCTGCTAGATCTGATCTCAACGCACCATTTGAAATGC
TTCCAATTTGTACTTCCTACGCTGCGTGGGCGCAGAGCTGGTGTCAGAAGTCTGGAAGTATAGTATGGGATAATGTGGATGGCTATGCCTCCTCTACACT
TCTGTTACGACCAGATAGATGCGCCCCGGGATACGTTAGTTCCAAGACTGGAGAGTGCTCGATGTGCCCTGCCGGCACGTATTCCGAGCCACACTCGCAA
GTCTGTACAACGTGTCCTGCCGGCACGTACGGACCTTCGGCTGGATTGTCTAGTGTTGCAGCGTGTCTTTTATGTCCGCCGGGTTTCAAGTGCGTAAGTG
GttcggcagctccagtggAGTGCCTAGCAGGTACATTTGCTGATGCTGGATCAACAGAGTGTTTAAATGTACCAGAGGGTTATGCAGGTTCATTCGATCA
GATGTCCCGAGGTGATCTCATTTCTTGCACGAATGGGACGTTCTCTAAGCCCGGGCAGCAAAGTTGCAGTGCAGTTCCAGTTGGATTTTACTGCTCCTTA
AGTGGGCTTGCTTGTGGCTATACGTCATTAGCTCCATGCCCCTCTAGAAGCGTGTACTGCCCAGAAGGAAACTCTAGTCCAATTATCGTACCTCCTGGTT
ATTACTCCGTCGGTTCAATGGTAAACGAGCAACAATCTGCCATATTACCTTGTCCGAGAGGATATTACTGCCGGAGAGGCACAACTTACCAATGCCCCCC
GACACGATTCGGCGACCAAGCAGGTCTGATTAACCCACTTTGTTCTGGCCGATGCTCTATAGGCTGTGTTTGCAAGGCTGGAAGCGTCAGCCGGTGCCCG
GATGGTCCGAGTGGTATTGGACAAGTTGTGTTGTCTCCGACGTCAATCTCATACGTGCTAGCACCTCTAGCGAAGCAACCCGGCGAGACCAACGACTCAC
TTATTCAAGGCGTTCTTTCTGCTATGAGCGGTGGAGCGGCTGTATCGACCGACATTTTTGAATTTAAAGACATCAACTTGACAGTTTTTAAGACGGGGTG
GGCTTCAGGGTTTGCGCACAATATCTCAATTTCGTATTTCGAGCAGTCACAGGTTGACCTGAAGTACGAGTTTCAAATGCCAATTGCTGGCTTCGATTGG
GGTGCCTTTGTAGTGCTGGATGGAAGTGTTGTGGTTCCTCGTTCAAAAAATGGCACACTGGCGTTTTCGTTTGTGTCATCATGGGGTCAGCATCTCCTCT
CTATTATCGCTGCTGAATCACAGTTTGTTGTCAAAAGGTCTGCACTATTCAGGAAAACATCTGATGCAAGTTTTCGCAATTTACGATGTGATCGTTTGGA
TGGACAACCTATCTTCTTGCACGTCGATATCACTTTGTGTGGTGCACCGTCACCGAATTGCATGGGTACTGTGACCATTAACGGTGAAGGGATAAGAAAA
GTTGCCCAAACCACGAATACCTTGGAGATATTGGTGTATTCTGGACTGGGCGTTCAATTTTTTTCTACCAGTGTTGACACTTCATCAACTGCCAGCTATA
TCCCCACGTTATCTGCTATGAGTACAGGTGGAATCGCAATTGTCATAGGCACAAACTTAGGGCCACTTCCGTCGACTTTTCGTGCTTGGCTTACAGGGTA
CGGTGTTTCTCAGGCAGCGATGGATTCTGCGTATTCTGGTTTTGTATTTGTGGGGGTCAATGATAACACCACACCAGCCACGTTTGAACTAGTTGGATCG
GGATCAACTTATAACTTACAGATGGCACTACCGCTCTCACTGGCGAGCTCGTACTACAACTTTACGAGCGTTCCAGCGGGTTATTATGCTATCCCTGAGG
ACGCGGCGAATGATCGGCGATACGAGCTTAAAAAGTGTCCAACAGGATACAGTTGCTCAGGTGGAGTTCGTGCACTGTCTTTCGTATTTCCAGGTTTAAT
TTGCGCGGGCAAAAAACATACTTTGGACATTAACGAAAATGACGCTGCCTTCGTTTCAGGCGTGAGTCTTAACCTCGTTACTTCTCCTACCGGTCTGACG
TACGAACTCCAAGCCCCCGTTGCAGGTTTATTCACATTGGATAATCAAAACCGCTTGACGCTCCTAAAAGCCCTCGATTACGAATCACGAAGTTCCTATG
ATTTGGCGCTGATACTTCGTGAGGCCCAAGCAACTGTACCCTACATGGCATGTCAAATCCATGTGAACGTGGTGGATGTCAATGAAGCTCCTATCGTGAC
CAACTACCAAGCTTCTCGTATAATCAAAGAGAATGCTTTGCCTCCAATTTCGCTTACACCTGTCTTAGGCGTTATTGATCCGGATGCGTACGATGCCTAC
ACGTTTTCTATCGCTAGCGGTGGAAATGGAAATTTCGTAGTTAGCCGAGATGGGTCTATTGTTGCAACTAATGCACTTGATTTTGAAACAACTCCCCAGT
TCGTACTGGGTATTGTTGCGAAAGACACAGGCGGTTTGGAAGGCCACGCTAATGTGGTAATTGTGGTCCAAGATGTCCCAGAACCACCAATCTGTGCTTC
TTTCTCGTTTAGTGTTGCAGAAAATGCAACCGTGGGAACAGTGATCGGGTCCATGAGTGACCATGCGTCGGACCCGGATGCAGGTGATTACTTGACGTAC
GGACTATCCTCTCAAATTGTGCCAGGAATGCTAACTATCGACTCAGCTACTGGATCAGTGACTTTAAGAAAAAGTCTCGACTTTGAAATTCTGGATTCAA
TTTTCTTTAAAGTGCGTTTTACGGATAAATCGAGTCTTCAAGTTACGTGCGACTACAACATTGCTGTCACGGATTCAAATGATGCCCCAGTTTTAACGAG
TTCTGTGTTTCGCGTTCCAGAAAACTGTGTCAGAAATGATTGTTTGGTCGGAAATCTTGCTGAATTTGCAGTTGATGAGGACAAGGGTGCGATACTGACA
TTTTCTTTGGGATCGGACAGCGATGTATTCTCTATTCAAGGCTCTCGATTATGGGTAGTGGGGGCTTTGGACTTCGAAAAAAAAGCTGTCTTCAAAATCA
GCGTTTCTGTACATGATGAACGAGGTGGCAGTGACGAAGCTACAATGACCGTGCAAGTTGTCGATGTAAATGAAGCTCCTACCGGCTCGGTATTTACGAA
AAAGGTTGCAGAAAACATTCCCGTCGGGACGGTTGTCTTCACGTTTGAAGCTAGTGATCCAGAAGGAGATAATCTTGTGTTCGCTATAGTGCACGCAGCT
ACCGGGTTTGAGAATATTTTTGCAGTCAAAGGCGGAAATCTGGTGACAAAAGCTGAGATTGACTACGAAGTTTTGGCAGTTCACTCTTTTGAAACTTACA
TGAGTATTTGTGATCCACTCAGACTGTGCACTGAAATTGGACCCAACACTATCGAGATTTTGGACGGACCAGATGCGCCGGTTATGGAAACAGCAGTAAA
GGGTGTCTCTGTTCCTGAAACCGCAAGCATTGGGTCAGCTCTGGATACTACCTTTTCTTTTtcagacgaagacgctgggCAATCTGCAATGCTGGCATAC
TCAATATACTCTGGTGATCCTCTGAATCAATTTGCGATGTCAAAATCAACAGGAGCACTAACAGTGAGGTCCTCACTGAACGCTAAAGTTGTGAGCGAAT
ACACTTTAGTCGTGCAAGCGACTGATTCAGATGGGCTGAGTGGATTTTCAAGACCAATAACAATTGCTGTGGAGATGGTTCCTTCCCCTCCTTTTTTCGT
TGGAAGCACTACACTCCAGACCAATTACAACATTGACATCAGCCAGCTGGGTGATGGATCGTACGCGACCGTCTCTTTACCAGTAGATGATAGAGATCCA
GGGCAGGTTGGCGGGATCTGTTCCATCACAACCGTGACCGATATGTTTTCAATGACATCAAGCAGTGACAGAAGGGCTTGTGAGCTTTCTGTTCTCTCAG
GTGCTTACGTTCCTGACGACCAGCGAATCAGTATTGTGTTGCGAGTAACGGACACTGTAAACACTTCTTCTTACAGTGAAGTTACGGTTGCCATACTGTC
GCGCAATGTTAACCATCCTCCTAAATGCACCAGCGCACAAGCCCAACTTTTGGAGAACTCACCGTATGGTATTGTTGTTGGTACTATTACTGGGAGTGAT
CAAGACGCCATTGATACAGTATCATATTCCATAGCTTCTGGAGACGATAACGACGTGTTTCACATGAATGCAACGAGTGGTGTTATTACTGTGGGCACGA
AATCACCCGATTACGAAACAACGCCCAGATATACGCTAAAAATTCGCGTTCAAGACGATGCGGGGGCTCCTCTACCTGGCCTGTGTACCTTCACTGTCGA
TATTTTGAACGAGTTAGAATCCCCGATGTGCGCTACAAACGTGTTCGCTACAGTATCTGAAAACAACGCGATAAATGCTCTCGTTGGAGCTGCCATCTGG
AAATCGTGTATTGACCAAGACACGGGTCTGGGTAATGCCACCACATTCTTGTTTGAAATTGCAGGTGCAAACCAAAAGTTTGCGGTCGATGTTTTTACAG
GGCAAGTGAGGGCAACCCAATCTCTTGATTATGAAGACAATGCTACTTACAACATCACGCTTATAGTCCGGAATGCATTCCGACCTACAAAAAGTACGTT
TGTGGGAGTGAATATAGAGGTGCTGGACCAAGATGACTCGCCACAGGTATCATTTCAGGCTGCATTTCCTAGTTCGACAGTGTCGGGTGTAGATATTCCA
GAAACTTCTGTCATTGGTACATTGGTTGGCCATGCGGTTGTTtatgatgaagatgctcaTGACGTGTACACCATAGCGTTACTAGACTCCTCTTCAACCT
TCTCACTTGAGTCGATCAACTCCACGACGTATAAACTGGTTCTGGCTAAGCCTGTGGATTATGAGACCCGTTCAATTTACTTACTCCAAATAACAGCGAC
GGATAAAGCTAAGGCATCGACGACGCTTGCCATGGTGGTTCGAATTACTGACGTCAACGAGGCACCATACTTTGAAGCACAACAACACTTTTTTATTGAA
GAAAA