Description :
From Genome Similarity Track
Location :
scaffold_680:10573- 14167
Transcript NameFunction/comments
g9836.t1hypothetical protein
g9837.t1 glutathione S-transferase, putative

Sequence
3594 bases(100 bases per row)
TCACAATAAAATGTGTGACGCGCGCAACTGCAACGAATCCTCGAGTTGAAGTTTCCCTCATTCTCAGATTCGCACACATGGACGCGGAGTTCATCAAGTC
CGATGCCAGCTCTGCTGTGCAGTCGGCTAGGAGCAGCCCATGGCCGTTCGACCACATCGGACGCCCCAGTGACACTCTCATCCCCCGTGGCCCACTCTGC
CAGACGATCAGTTCTCTTCTCGGTAAAGCGCACCAAGGGCAACTCACCTTCAGCGACGCCGCCTCCGCTCTTCCCGACGCACCAGGACTCGCCTTAGATG
GTGTGGGAACGCTACCTCTTCCTCTGCGTGATGAGGTCGCGATGAAGATCGTGGACAGCGCTGTGATAGAGCAGGAGAACCTCTGGGTGGTCTTCCCGCA
CCTCATACACATGAAGAATCACTTGTGGGCTACGGGCATTCAGATTCTCGCCGAGCTCAGCTCACAACAACTCGGATACAAGGACGTCGTGTTGCAGCCA
GCTCTGGCTAAGGTGATGGTGGTAGGGCCGGGAGGGAAGCTGGACAAACAGCAAGCTTCGGACATTGGGCGCTCTGTGGCGACTTTAGTGGTGATCTTGC
CTTCCGAATACACGGGAGGAGACTGGATGACATACAATGGAACGGAGAGTGAAACACGTTATGACATGGGTAAAGCGGCTGACGTTGCAGCGTTCAAGCC
ACACTATGTGGTGTTCGCTGCTGGGGTTTCTTTTGCTCTGGAAAAAGTGACGAGTGGGTACTGCGTGGCGATGGTTTACTCGCTGTGTCTGCCGGAAAAA
GTTACGACTCATCATATTTCCCCCTTTTTGTTGAGGAAGGAGCTTGCTGAAGTTATCAAGCAGCTCAAGGGAGGACCCGATGATGCTGACGATGGAGATG
TGGAGATTGGGGAGGACGAGATACTGGCGCTCTCGTTGTCGAAGCCATTTACGCTCGTAGAGTACACAGGTATCGCAGCACTCTGCGATGCGGATCGCGC
TCGATATGAGCTACTGCTGGAAGCGAACAAACTGCTTCCCCCGTCAAAGCAGTTGGTGTTTTATCTCGCGTGCCTAGGCGTTGAAGTTCCAGATATTGGA
GATCGAACGCAGAAGCAAACGGTGCGCTGGTATTCACTAAGTGGAAAGAAGACCGGGGTACGCTTCGCGCAGTTACTCAACTGGACAGAGGCGTTCAATT
TCTTGAATCCCGACAATGAGACGCTGAGTGATCTGTGGGGAAATGATGACACGAAGTTGCCCCAACGCACTGCTCTTGTTGCCTGGCCCCGCTCCGCTGA
CATAACAAATGCGATTAAATTGTTTGGAGAAGCTGCCGCTGTGCCCGTGATCATCTCACATGACTTCATCAGTGTCCGAACTCTGAGAAGTCTGCTTGGA
AACGAAGGATACGGGGGTAAATACTTTCCTTTCGTGCACATGAGCGTGGCGCAAGAATTCAAGACAACAAAGGGCATCGATATCCTCTTGCTTTGTCGAA
AGTTGGGCACTGCTATCATCAACTTGGGCGATGTGAAACTGGTGGACACATTCTTCAAGAAGTACGTTACTCAGCTGAGGGACAAGCAGAGAACCATTTT
CATTCGGTTTCTCCCAGATTTTGTGCAAAAGTTTGGCTGGAAAGAGGTCCAAGATTCGATTCTAACCACGATCGATGTGAAATCGCATGAAGCTCGTTTG
GACCGAGCATTGGAACTGGCCGATGCACTCCGCGGCGACTTGGATGCGCGACATGGTTTGATCGTTTTTGCAGAGGAGAAGTCTCAATCGTGGAATTTAG
CTCAGGTGAATGCCTTTGCAGATTCGGGAAAGCTCTTCGCACTGCTGAAGCACATATTGGCGTGCAGAAATTTTCAGGTGTTTATCAGGTTTTCAGCAGT
ACTGAAAAGGATCCATGAGAGATTTCTTGGAGCTGCCATCGATCTTCTTGCAAACTGGGCGGTCGAGACGAGCTCGCCGGAGTATCACGCCACATTAGTC
TCGCTAGCGACCAAACGCCGTAAGTGGCTACTTGCTGAGATTGAAGACTCCAAGAAACCATTTTTGTGGGCAATAACAGTCTACAACTTCCCGGACTCCC
CGCAGATATTGATGTTTCTTCAAGGGCCAGACGCTGAATTCAAGATTTGCGGCTTCTCGAGCATTTCAGAAGCTCGAGATCGCGTTAAGGTTCTCAGCCA
CAGCATTAAGGGGCCACTCGAGTTTGTGGCTGAAGGACGTGGTCGTGACGCGTTTGTACGCATTTTGAAGGCTGGCGGACAATTTGATCCGCGCAGAAAG
AAGGCGTTGAAGTACGAAGCGGAAATCAACAATCTGGAGCTGGTGAGCGAGATGCTACCACAAGATGAAAACACAGCAACAGTCAATACTGACAAACCCA
TCGTGGGAAAGAAACGGCTGCGGGAGGAAGACAGCGACGATATCGTCTTGGAATAGGCAGCGACCAGAGAACTGTACGGGTTGCTACAGTAGTAATTTCT
TTTTCAAGCTCTCAGGCACTTCGTAGTACATGAACTTCACGTTTGCAGTATCATAATTGTGTCTTTCACCGTTTTCATGATACAGGTTTGGTGTGATCCA
TTTTCGTTGTTCAAGGGATGAATCGCTGCAGCATTCATTCGGGCGAACACAACAATCAGTTGACCTTCATTCTTTGCAAATCTTTTCGTGGAAAGACTCC
AGCAAACTTTGCGTGATCAAGTTTTATTCTGCGTGCCTCTTATCCATCGGCATTCTCCGATTTCCTCCACTCCACTCAAGTGCAGCCTCAATGTCAACGT
TCCCGTCGATCAAGCTCACGTATTTCAACTTCGCCGGCCGGGCTGAGTCTGCTCGACTCGCGTTCTACGTTGGCGGCGTCCCCTTTGAAGACAATCGACT
GACCCGCGAGGAGTTCGCAGCTCTGAAGAGCTCATTACCACTCGGCCAAGTTCCGGTGTTGGAGGTGGATGGGCAAGTGTTGACGCAGGCGTTCGCCATC
CTGCGGTACGCCGGACGCCTCGGCGGTCTCTACCCCACCAATTCCCCGTTCGCGGCACTCAAAGTGGACGAGATTCTCTACGCTTTGTGCGAGATGTGGG
AGCAAATGCTGCCGTCCTTTCAAGAGAAGGATGAGACCAAGAGGAAGGAGATGCGTGAGGAGCTGGCGACGGTTACCATCCCTCGCTATGCCGCTCGGAT
TGATGCTCGTCTGGAAAAAATGCACCAAATGCCAACCTTTCAATCGGACACTTTGTTTGTGCACGAAATCGCTCTGTACACGTCGACGAAGGCGTTCAAA
GACGGCATGTTTGACCACATCCCCGCTACACTTCTGGATGGCTACAAGTTCCACAAAATGATATTCAACAAGGTCACAGGGAACCAGAAGGTCAAAGAAT
GGTACAGCTTACCACACGGCACGCCGAAGCTCAAGCTGACCTACTTCCCTTTCGCTGGTCGTGCGGAGCCCATTCGTCTCGCTTTCTTCATTGGAGGCAT
CGACTTCGAGGATGAGCGGATCTCGTTTGAAGAGTACGCGAAGGTCAAGTCGAACCTACCTTTTAGCCAGCTACCCGTGCTGGAAGTCGACGGC