Description :
From Genome Similarity Track
Location :
contig_9:105710- 107249
Transcript NameFunction/comments
g2221.t1cystatin-like cysteine protease inhibitor domain-containing protein

Sequence
1539 bases(100 bases per row)
GCGTCACGCACAATGTGTGGACCGCCTACATCTTCACGTTCTTCTTCTGGTCCGCCCGAAGGTATCAATCGTCCCCAATGTAGCAAAATGTAGCCATGTA
TCATTCCTCACCTTGTCCGTCATCGCAACTGTAGTATTCTGTTCCAGCAGGTCGTGGCTGGCTACGTGTTCGTGCTCACGGCCTCCAACAAACCCGTGGG
TATCGTCAAGGGCATCCAGGGCATCTCGCAGCTCGTCTTCTCGCTACCCGGCGGCTATTTCGCGGATCGTATCCGTCGCGACACGATCCTGAAGCTCTCG
GGAGCCATTGGCATCGTCGGCGCCGTCATCACCTTCGTCTCCGTGGAGTTGACGTCCATCAACGGCCTCTACGTGGCGTTCGGGCTCTGGGGCCTCTTCG
CAGCCTGCCAGAGCCCCGCCATGGAGGCGTTGTTCGCTGACTCCATCCCCCTGGCAAGCGCAGCTTCCCGTTCATGATCAAGTACAACATCAGCAACTTG
GCGCAGATGCTGGGGCCCGTGCTGAGCATCATGCTCTTCCTCTTCTACGGAGACCAGTGGCAGCTGCCGGAGCTCAAGCCTGTGCTCGAGTTCGGCTGTG
TCTTGGCTGTCGTGGGATCGCTCATCCTGTTCCAGTTCGATGACGACCGGGCCAAGGACTATCTGGTCGACAAGACTCAAGAGGAGAAGGAGGAGGGAAG
TGCTGCTGGAGAAGATGATCGCACCGTCTCCGCTGCGCACGCCAAGCTGGTAGGCAATGGTAATGAATTCGACATGGTGTACGACTACTCGGACGAAGAC
GACATCACAGTGGACGACAAGTCTCCCCCGACGGCGACCGAGAACACGGCGCTGCTGCTGCTGAAGGGAAAGACCGCCAAGGAGATGGATCTGGAACGAC
AGCAGCGTCTACAGGAGGTGGAGGAGGAGGAGGAGGGATACATGGCGCACCTGGACGCCAAGTTCCTCTGCTTTCGCACCAAGCACGTGCCGTACATCCT
GTTTGTGTCCGACTTTATCCTCAGCAACGGGGCCGGCATGACGATCAATTTCTTCCCGTTGTTCTTCAAGAGGAGTACGGACTCACGCCGATCCACGTCT
GCGCGCTTTTCATGAGCCAGCCGCTTGTCGTCATGATCCTGTCGTTTATCGCGCAGCGGTTGTCCAAGCCGTGCGGACGCATGCCGATCATTGCCTTCAC
CCGCGCATTCTCCGTTGCGTGTCTATTCTCCATGGCGTACGCACAGCCGATGGCTCTGCAGATTGCGCTGTTCCTGATGCGTGGCGGGATGATGCGCTGC
TCGCAGCCTCTCCGTCGGTCGATCCTGATGGACTACGTGCCCAAGAACCTTCGTGCGCGCTGGAATGCTTTGGAGGGTCTGTCGGTCTTTTCGTGGTCCG
GTAGTGCAGTTCTCGGCGGCTTCTTGATCGACGCGTATGGATACCGAATGTGCTTCATCATCACGTCGTTCGTCTATTGCGTGGGTCTATCCTTCGAGAT
GGCTCTGTTGCCGCTCACAAAACACGCCGTTGAGAAATA