Description :
From Genome Similarity Track
Location :
Scaffold_3318:1057- 2578
Sequence
1521 bases(100 bases per row)
CTGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATATCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATAGCCTCTCTCGCGCGAGC
AGTGCGAGGTCATCGATGCTTTCTTCACGAGAAAGCGTAGGGTCAGGACATGGTGTCGGGATTCGAGATACGCGCACTCGACGCCGACTTTCTGCGTTCG
TAAGCCGAACGGAAAGTGGCGTCTGGTTCACCTTTTATAACAAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCCAATCCCCACGAAAGGATGTGTT
GTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCG
GTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCACAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGCTCC
GCCCTTTGCGTACCTTCGTACTGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCT
CCGTCGAGTGTTGGACGTGATGCGAGCGAACCAGCTCTACGCCAACATCGACAAGTGCGTCTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTA
AGCAACGTGGGCGTTCGGGTTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCATCGCCCCGATTCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGG
CCATCTACCTTCACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGGGCCTCCTTCAGAAGGACGTCGACTGGCGCTTGGAGCAAGAGCA
CCAGGATTGACAGCATCAAGGCCAGTCTCCAATAGGCCCCTGTCCTGGCCCTGGCGGACGAGACGAAACTGTTTAGCGTCGTCTGCGATGGCTCCGATTA
CGCCATCGTTGCTGCAGGCCGACACGGCTGGACATGAACGGGTCATCGCGTTTCATGCCAGGCAGCTCAAAGCCGCCGAACGGAACTACCCTGTCCACGA
CAAGGAGCTCCTGGCAATAAAATATGCCCTTGTGAAGTTTCGGGTTCATCTTCTGGGCTCCCGGCCCTTCGTGATCTACACAGACCACGCATCCTTGAGG
ACGGCGACAAATTCGCTCACCTCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAGTACAACTTCCGCGTCGAGTACAAGCCGGACAAGCTGAA
CGTGCTTGCGGACGCCCTCTCTCGGCGTCCAGACTACGAGCTGGCCTACAGCACACGGGTGACAGCGGATCTATATGATCGGATACGCATGGCGTATCGG
GAAGATGAGGCTGTCACGCGTATCGTCAAGTTCCTCACGGCAGGAACGAGCGCGAAGTCCGACTGGCTTTTGTCCCGACAGCGCTCCCGGCTCCAACGAT
ATGAGCTAAAGGATGGACTCC