Description :
From Genome Similarity Track
Location :
scaffold_5:105694- 108307
Sequence
2613 bases(100 bases per row)
TCAACATCGATGAGGGTCATATTCCAAGCAAAAACAGCACATGCGCTGCCACAAGTGCCGACTTTGTCGAAGCGACCGCCATCTCGCTGAGTTTGGTATG
AAGTCCTTGGGCAACGCGTGGATCGAGCTGCTCAAACTGTCGTCGATCACGTCTGATGTCTACGGCCCATTGCTGCAGCCACTGCAGCACCATCCACCCA
TCAGACGATTCATCTTCTTCGTCTCCTTCTAAAAGCAGCAAGAACGCAGTGCATAATGCGTTGCGCACTGCACCTGACAACGTCGCTATGCAAGGAGTTT
TGATGATCGTCGTCGCACGCCGTAGCAACTCCAGATCGTCTTCGACAATGCACAGACGAAACGCTAATTCGTACTCACCGCACTGTGCCGCTTCCAAGGC
AGCCTCGGCACGAGTGAATTCGATCTCGCCAGAGTCATCGTCCTTCTCGTAATTTCTAGCTTCTGCCTCATTGATATGCTGGCGACCCTGCGGGTCATTG
TCTGCTTCGAGTAAGTTCATCGCTTGGGATGATCTCCGCTTGGGGAGGGAAATCTGAGGGATGCCTTGTTGCTGAGAACGCCGTGAATGTGTCTGGGCTC
TTTGCTTCGCTGCAAACTGCTTCAAACTTGTAACAGCTTGTACTGTTGTTGCAGTCAATGGGCGTGACTTTGTTTGAGAGACAACTGCTGTGGATCTAAG
CGGAGCGTTGTGAGCTGTGAATTCTTTGCGTCGCTCTTTGCGGAGAACTTCACTGCTCTGTTCGTCTTCTGATCGCGGGTGATCCGCTTGGTCGCCATTT
GCTGGTGCTGCAGCCTGGTCCATGAGCAGATCCATGAACCTCTCGTCATCTTGGTTAAGCTCAGCAGGTAGCAGGATACTTGTAGGTCTTGCTTCCGTCG
CTATCGTTGTATTCCCCCGCCGATTTGGTCGAGACCGGACGACTTTTTCTTGGCTGGTGGCACTGAAAATTGGCGCTAGATCGTCTCCGTCAGTTGAAAC
ATCATGCGAAGGTAGAGCCTCGTCTCCTGGTGTGGGATCACCGAAGCTTGGTGTGTCTTCCTCCTCTGTCGACTCAGAAGGCAAGGGTGACGAACGTGCC
CTTGCATCACTCACAATCGGGATATGAGTGTCACGATCATTGACCGCTGCAGGTGTTGCCCAACGTTTACCAATGTACGAATAGGCAGGAGGGTTGGGCG
GGACAAAGTCGTAGTCTGAACTAGCGTTGGAGCGGGGACCACTGGCTGTTTGCGGGTACAACTTCTCCAAGCGTTCAAATGCCAAGGCTGCAGGAATGGC
AGCTTCGCGAACAAGAGAGACCGAATCGTGTCGGCCAGCCAGCACAAGAGCTCGCACTCGCTCCTAAGTAAGGTCAACAGCGAAACAGATAAGTAAGACT
TGTACTGTACATACAGTTCAAGGTGACTGCACGCACCAACTGAGCTTGAAAGTACCCTCTCGCTGTCCCAACGGAGGTGCACCAAGCAGAGTCCTGCAGC
GCAAATGTGTCAAGTAGCATTGTCAACAGCTCTTGTCCACGCTTCCGAAGTATCCAGTCGTCACGAGGGCCACACTGGAAGGTATCCTCGACTGCTTCGT
AGATTGAAGCGATGTAGGGAGCAAAGTCGTCACCGAGCTGCGTAAAAGAGGCTTGTTCGTTAGCATCTCGCGCTAACTGACACGCCGATTGCAACAGCAG
AAACAAAGGTGAAAAGGTTGCAAACATTGTGCTTCCGTCCATCTTCACAACGGTCTCAGCTAAAAGCGCTTTGAAGAACGGGCGGATGTGTGTGGCATGG
GCGAGCATTGTGGCGGGCCCGGGCACCGACACTCCATCAAAATCGACAGGGTGAAGCAGGCCACAAAGGCACCTGGTGGCTGCCTCCCCTATAGCGTTTG
CCTCCTTGGCAAAAACTGCAGCCACAGCTTCGAATGGCTGCTGAGTGTTACCATTTCCAGGAAGTGATACACTGGGGCATGGCAGAACATACAAGGCAAT
GGCCGACATCAATATCACACATGCATCCGTCGTCTTGGTGTGTCTGTCACGAAGACGAAGGCAAGCATAGGATACAATCCGAGGCAAAAGTTTGGCTGTC
TGCGTTGGATGACATCTGCAGAGAGCTGCGAGTAGAAGAACAAGCATCCGCCGTGTTGACGAGCGAGTGGGTTTCTTCAGAAACAACGCATCGGTACAGT
GTCAGCACCCTCAAAGAGCAGTCAAACATCTATAGCAAGTCGTTCACCTTGTTTTTCTCGATCAGAGAATATACCTCCTTCACCAATGATGAATCCAATC
CTGGTAGAGATTCGCTGCAGCAGGCGAGTGGCAATCGTGATAGTTAGACAAGACTTGGTGTTTGTGCAGGTTTAAATTTCTCACATGAGCATAGCGAAAG
CTTGCTGCTGAGTATCTCGGTCCTCCAAGCGACCGATTTGGACGTTCAGGTTGCAAATTTCTTGTTCTTGTCGTTCCTTGGTCTTGCGGTCCTGCTTTCT
CTTCTTTATGGTGCCTTTGGGACTCAAACTCCCGTTGATGGCCCCAACGACTCCAAATTTCCCATTTTGCCCTGCAGCCCGTCGTTGAAATTGAGTCTCC
ATCATTCTTAGTG