Description :
From Genome Similarity Track
Location :
Scaffold_487:10569- 16074
Sequence
5505 bases(100 bases per row)
NNNNNNNNNNCCTGCGTCAGTAAACTCCATGTCTACGTACGGGAGAACCCACGGTGGCAAGGTGGACGAAGTCGGCACGTAGGGCGACGCCAGACAACAC
TCGGTGAGGCAACAGCTCAACCGACGGTGCACCACCACGACGCGGCACCGAAGTGTAGGTGGCCATAATCATGCGTCCAGGACCAGCATCGAGAGTCCAA
ATAGGCGGCCGAGGAGACGCTGGAACAGGAGGAGAAGATGCTGGGGCTGGGGGGCTTGCTGGTGGCGAAGGAGGCGGATCGGCAACGATGATTGAGGAAG
TCATCATCGGCGAAGGATTTGGCAGAGGTGGAGTCGGAGGACGAGCTGGGACAAGATTGCTCCAGTTCCTCTCGGAATCTTCAATTTCTTCGTCATCGAG
TATGCTTGAATGATCGGTGGGGGGCGGAACATCACCGCCACCACTGGGAGCATCAGGAGAATCATCAACCGAAGGTTCATTATCATCCACGTCATCTCCA
TGATCGTCATCAGCATTCCCATCGTCATCAATCTCCATCGAAAAGTCGGGCGAAGACACGATTGGTACGACAGCCGTCGGAACAATCAGAGCCGGCTTTG
AAGACACGGAGGCTGGTGGAGCAGCTTCAACAGGGGCAGGCCCTGCTGTAGAAACCACTCCCAAGACTTCAACTGTCTTGGACGTCGGAACAGACACCGA
AGCAGACTTGCCTTGTGGGACAGTTTGGTCCGACTCTTCACCTTCGTCACTTGAGCCAAACATCAGAGCACGTATGTCGGCTGGAGAAGGTGAAATCGTG
GACGCTGGTGGCTTGGCCACATCGTGTGGACCCTGAGGCGGCGGCAAAGGCGCGTCAAGAGAATCGGGAACATCGTCGTGATCCCCAGGGTTCACATCTT
TACCCGAAGGCTCTGTAGCAGTTTCTTGAACCGAAGGAACGCTACTTGGATCAACAGTCCCGATGTCCACGTCACTCTGGTCGCCGCTGAGGTCGACCAC
GGCGGGAGTCGAGGAAGACGCTGGTGTAGGAGGTGGCGACCATGAACTTGGAGAAGACGGTACAGACTTGGACCGAGTCTTCATATGACGTCGGGGCGAC
TTAGCAGGAGAATGAGGACGAGATTTCTTGCGCTTCTTCTGGGCCGCCTTCTTCCACGCCTTCGGACCGAACTGCGATCGACGAGCCGACTTGGGAGTTG
AAGTATCGGCAGGTGGCGCATCACCGAGACCGGCAGCTGCCATCGAAGTACTGGCCTTGTCCGTTGGGATTGGAGCCTTGTCTTCGTCAGAGTCGTCCGG
CTCGTCGTCTGAATCCTCGCCACCTGGTCTAAGACGCTTATGGGACTTCCCATGGGCCACTTGGTGAGCGGCTTTGGCTAAATCTGCAGGAAGGTCTTGA
GGATCGTCCGAAGACGCGGTGGCAGACTGAATGCGCCGCAAAGCGACTAACGTCTCCTGATCCAAGTCCAGCGCGTCCAGGTCCAGCTCACCCGCAGTCA
GACCTATCACGAAGGATTGTGAACGAACGTTCGTTGCTGAACACACGGTGGAAGGAGCGACATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTAGCTAGAGTTCACGTGGGATTCCCAACACCACAGAGCGTTTTGGCAAACAAACACGATG
TTGTAGCAAAGATGGATACAGAATGTCTGGCCGCTTATGAGTACGCTACGTGAGCTACCAGTAAGGCGAAAAAAATGTCTAAACACAAAGATTCCGATGA
TAAAATCCCCGTCTTTGGAGACTCTCGTGATATGAACAGGCTTTGTAGAGTTTGTGTAAAGCTACTATGGCTCTCTTTATCATTGATGGGTCTACAAGGT
TCAGGGGGCCGTTTTTGGTTAAGAAGAAGAGCGAGGCGACGTTATTTATCAAAGCCCCGTTGGAAAGATGCGGACATGAATCCCCAGAAGGTACAACGAC
TGCGCTCTGACCAAGGAAAATGTTTTTAAAAGCAACGATATGAGAGGCTACTGTGACGATCATATAATTGAAAAGCTGCTCACGAATGCGCACTCGCCGC
AGTACGTCAACTTCAACGGCCCAGCGTCGTCGACGCTCCACAAGCCCACCCCTGGAGTGATTTCAATCCAGATTTCCTTCTTGGGACGGCACTCGACCTA
AAGAGAAAGTCTTACTTCTTATGTGATTCATTTGTAAAATTATCGCGCTGAAAGAATAACGTTTCTTTAGCCCTATGTAATTTGATAAACCAGTTATCTC
CCTGTTTAATTTCTTATATCACAGAAAGATGTGGTGGTTTCTCTCTTTGAACGTAAATGAATGCGCCACTTGGTACCAAAAAAAAAAGTTCGTTTGCCCT
TTTATAACCAGTATCCGGTGGACATCACACAACACATAAGAATGTTGCATGTGGCGGCCGCGGGTAACATCAAAACTAATTCAGCCAGTGAATGTTGCTT
GAAAAAGTTTAGGTAAAGCAAATTTATCTTTTCAAGTAAAAATAACCCAATGGGTAAAATGAAATTTATCTTTACCAGTTGTGGCAGCAATTTGGACGGC
AGCTTTCCTTGATACTGTTGAGGCTCCAATCGCAATAATATCGGTAACAACGGCGCTCACATGACTTTTTCTATGGCTTGTAGCATGGTGGGCATTTCTT
CTAAGAAGGTGCGCCGTACAACGTCATTATAAAGAGCACTGTTTCTTTTAGCAATACATTCGTTACAAAAGGTGACACCCCTGAATTTCCATTCAGCACT
TGCGCCATCTTAAACGTCTTTGTTTTCTCCACCATCTTTATTGGCTTTTGGTGGAGATTCTCGCACCGGTGTCCACGCAGTCCAGTAGCAGCAACTGATA
AACTACTTACTGCTAGAATCACTACTTTGCCACTGGAAATCTCAGCTATAGCGAGCAGTCGAAGAATTTTATTCCGAGCTTCAAGTATCACTCGAAGCTT
TATGCAGTAAGTAAAAGTAATTAGTGCTTCATATTTGCGCAATTCTTTAAGTTCGATTGCTGATGTTGAGAACGCAGTAGTATTTTCTTTTATCACAGCA
AATTAACATATGTATGGCTTCTCATGTTTATTGGTCGCAAGAGTTGAAATATCCCTGCTGAAAAAATGGTGCTAAGATACACGAATCCTACCTCCATCAA
AGAGTTTGTATTGGGGTTTGTATAATATCTAGAAAATGAAAAGTACGTGATGCAAGTAACAATTATGCATCTAGAGAACAGTCGATGCATATAAGAAAAG
CGCCGCACTAAGTACGTATCGACGCAGGTTATTGTCGTCTCGGCATTGATCAACCCTGGTACTCGTTTCATTCTCAAAATTGCTTGCTCTGAAAACGACT
AGTACGATTTGTGCCACGTTAAGAGGGTTATTAACCACCACCACGCGTGCCAAGCAATGGAACTCGAAATTGAGTCATGGCATGGCGCGGTTAGGAATAG
AATCGTCCTGCCATTGTGCCATCATGAAAACCCCTTTTTTACATACATTGATGAAGATAAAAGTAGTATTGTACATGACAATTGCGCTTTGTAATATTCT
ACGCG