Description :
From Genome Similarity Track
Location :
Scaffold_179:105637- 106988
Transcript NameFunction/comments
Aphin_H310_13760Monovalent Cation:Proton Antiporter-1 (CPA1) Family

Sequence
1351 bases(100 bases per row)
TGGTGCTTCTGGGCCTCTTGGTCCTTCTCGTGCTGGTGTCGTTGGGCTTGGATACGTACCGATGCACGCTCTTGTCCAAGAGCGGGCTCGCGTTGCTGGT
TGGGGGCGTTGTCGGCCTCCTACTTGCGTCGCAAAACACGGAAGCGACAGCGCCGTTGCAGCTGCATCACTCGATCTTCTTCGACGTGCTGCTTCCACCC
ATCATTTATGAGGCAGGGTTCTCGGTCGAACGAACTACGTTTTTCCGCAACTTTGGTGCCGTCTTGGCCACTGCGATCTGGGGCACGTTGATATCGGCGT
GCGTGACTGGGCTCATGCTCTACCTCGCCAGTGCGTCTGTCCCCATTTCAAAAGTGGCGATGCCTCACTGTCATCTCTTTGCCATAGGCTTGTGCGGATG
GATTCCAAACATCGACTGGATCGAGGCCTTTCTGTTTGGGGCGCTCCTCAGCGCAGTCGACCCGGTTGCGACCCTCGGGGTGTTTCAGAAACTGAACGTT
CCGCCCGTCCTGTTCAACGTTGTATTTGGCGAAAGCGTTTTGAACGATGCCGTGGCCATTGCACTTTACAAAGCTCTCACGTCGTGGGCAGACGCTGGGA
TGACAGTGTCGGTACTGGTGCTCGTGGTGTGCCAGACATTTGGGATTCTCGTTGGGTCGATCTGCGTCTCCATGCTGCTCACGCTCGTCGGGTCGTCCAT
TTTCGTCCAATTTCCCGCCTTGCGCGCCTACCCTGCGTACGAGATCCTTCTCTGCATATGCGTGAGCCTGAGCACATATTTTGCCGCCGAATGCTGTGAG
TTCTCCGGCATCGTCGCGTTGTTCTTCAGCGGCATCCTGACCGGCCACTACCACTACCACGTCATGTCGCCCGAGTCGCAACTCGCCGTGCACCACACCC
TCCAGACCGCGTCCTTTGTATGCGAGACCCTCGTGTACGTTTTTGTCGGCGTTGCAACAGCCCTCGTGCTGTGCAGCAATGCCACCAACGAAACGAGGTC
GCTGTCCCATTACGGTGCACCGAGCAACTCGACCGAAATCGTCGTGAGTTGGTCCTTTGTCGGGTGGACCACGCTGAGCTTGTTTGCCGGGCGCGCCTTG
AATGTTTTTCCGCTCGTTTCGTTGACGAATTACCTCCGGTGTAACCAGGACACACTGACGTTCCCGATGATGGTCGTCATGTGGCTGACGGGCCTGCGCG
GCGCCGTCGCCGTCGCCCTCGTCACCGACTGGTCGTACGTGCGAGAAGGCAACGACAGCGTGGGCAGCGTCAAGCAACTCATGGTGACCACGACCCTCTT
TCTCGTGATTGGAACGACGTGGATTGTGGGAGGGCTGACAGGGCCGCTGCT