Description :
From Genome Similarity Track
Location :
Scaffold_352:10562- 13956
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_352-fgenesh-gene-0.8RNA binding motif protein 25
Pytap_DAOMBR444maker-pag1_scaffold_352-snap-gene-0.16Rhodanese-like domain containing protein
Pytap_DAOMBR444maker-pag1_scaffold_352-fgenesh-gene-0.9Pterin-4-alpha-carbinolamine dehydratase

Sequence
3394 bases(100 bases per row)
ATGGGAACCGAAGGTGACACCATTCCCTTCGCTGCGGCAGGTTTCACATCTGGAGTACTAGGATTCGTCGCTGGCTTCACCTTCGATTCCAAGTGTTTGC
CGTTCTCTGTTGGCTTTTGAATCTCCGCTTTGTCCTCGGTACTTTTCAACTGGGCGTCCTCGGCGGCTTTGCGTTTCTCCTCTTCGTGACGCAGGCGCTC
CCTCACAGCTTCTCTGCGTTTTTGCTCTAGTTCCTGTTCACGCTGCTCCTGCGCGAGTCTAAACTTTTCGATCTCGCTCAGAATCATCTTCTGCTGCACC
TTCTAAGGTTATCAAGCCATTAGATCCTTGGCTACCGACAACTTGATTCAGCGACTTACCTCTGCCGGAGCATCGTCGCTCGTTCCATTCTCTCCACCTT
CATTGGACCCTGTCGTCGCCTCTCCTGCTGTCTCGTCACCACTTGCACTACGCTCTTTCTTCCCCAATAAATCTCCCCAGATTTCGGGGTGGTTCTGGAT
GCCTCCCATGAGTCCGCTACGCTCGTCTTCCAGCATCTTGAGCACCCGCTTAACTTCCTCGTCACGTCGTTGCTCCTCGATCTTCATCTTTTCCGTCATT
GCGGCCGTATACTCATCGAGTTTGGCCTGCGTCTTGGCGTCCACCTTGACTAGAATCTGCTTCGAGTCCATCGTAAATCCATTGAGCAAGCGCAGCGCCC
TCAGCACATCCGTGGCCCCGGCATACGTGCAGTAACCGAAGCCCTtGGGTTTGCACGTCAGTGGATCAGTCGTGCGCTTCCATGACAGTACAGTACCACA
ATTCTGTGCCACACACAACGTACGCATTAGCTGTGCGACAGACGCTTCTTCGTGTCCCCaTTCATCGCACTTACCTCGAGTAGGGTGCGGATATGACtGT
CATTCAGATCGGTCGGCAACTTCCCCACGAAAaCGTTTAGCGGACCAGTTTCCGGGAGCGGCACAACTGGTGCAACGACTCCAATACCTGGCGGCAATGG
CATACCAGGCGCCAGTCCATGCGGGGgAGgCATCATGCCTGGCATTCCcATGGGGGGTGgTCCACGACCTGGAGGAAACATCATGGGTGGAGGACCTCGC
GGAGGCGGACCACGCATGGGCATCATCCCCGGTGGCATGCCAGGCACTCCAGGTGGAAGCGCACCACGTGGAGGTGGTGCACCTCCCGGTGGAGGACGGA
AGGGCAGCATACAGCAACAGTAAGAAGGAGCGCCGCTTGTGTCCCTGTGTTCGTGCCGCTTTGGCTGTCGAGGCAGAACATGCGATGAAGAAATCTACtG
GTTTAGATGATCAGACCATTTCCCGGTGAAGAACCGGtaTCAATCCGGTAAGTATGTGTTCTATTTTCTGCGGAAAGTTATAATTATCGACCAATGAGAG
AATTAGAAAGAAAATGAAGCTGATCTGAATGCGGGTTGGACTCAGGACACTCCATGGAGGAGGCGTCGACGCCTCTGTGAGGTCATTGTACGAGTTGCCG
CCGAGCCAAAGGGAGAAGAAGATGCATCGCGCCAAGCCGAAGACGCCGCTGAGCGTACGAGACGCAGCCTCGTGGGGgATGCAATGCGGCTAATGGAGTG
ATGTGTGGAGCAGATTATGGACAAGAAGATCCCTGTGAACCccAAGTACGCaaNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGACTGGacaCATTAGgCTGATGATGTGTGTTGTCTTTCTtGGTTTAGCGAaCAAaGAGTtCCTTAAGcGCCTT
GATGAGACGTTTCGCCGCGTGAcTCCCcGTAACCTAGAAGAGCTCCTGGCCGAGTATGAAGACAATGGTGGAGGTAGTTCGTCTCAGCCCGAGATGGTCG
CGAAGATGGTGAAGAAAAGTGATGGCAAGTTTGTCATGGAGCGGGTGCCAGCCGAAGACAACAACAACCAGAGTAGCAACGCTGGTGGCCCACGCATCGT
GAGTTATGAAGCTGAAGAAGCCGAAGAGTATGACCCACCGTATTtGATTCTTGACACGCGCACAAAGGAGGAATTTGCTGTCAATCGAATCCAGCGTGCC
AAGAACTTTCCAGCCTCGTACCTGAACCGGGATGTGGTACTCCCCGAGATGCATCGATTCAAGAACCAGGAGAGCAAGCTGATCATTATCTACGATCAGG
ATGAGAAGACAGCACCACAGACCGCGCATACGCTCGTTCAACGCGGTTTCGACAATATCTACGTCCTCACTGGTGGTCTTGTTGACTTTGCGGACGAATA
CCCAGACCGTATCGAAGGCTTGCCTCTGCCGAAGAAGCCTGTAGATTCATCAAAGAAGACGGTGTCGAAAGAAGTGTACAGGAATGGCTCAGCAATGTCG
ACAACTGGTCCAAAGAGTGTGAAGAGTGCGGTGACAGGTGCATCGAGGAAGAAAGCGGACGGTGGTTCCGATGTGAGCTCGGTCATGAGTTCGTTGTCCG
TTGCCGACTCGGTGATCTCCCGTGCGAATGCTCGCAAAGCACGAGTCGTGACAGGCTCGAACTACAGATAGAATCCATCCACACAAGATAGAATCGCTGA
TCAATACGACAATTCGATTTTCTTATCATTGACCACGGCATCATCATGTGAGACGTCACGCCACAACGCACTGCATGTTCAAAAaCATCGCGCTGTGTCT
ACTTGAGGgCCTCAGCGTACTTGTTCATGGTGAGCGCCATCTCAATGTCCTACAAACCACACAAGTTAAGCACATTTCCTGAACGCTCATCCGTCTCAAC
TACTACGTACGTTCTTCGACAGTCCATTACAGTCGTGCGTGCTGAGCGTCACTTCCACACGGTTGTACACGTTAAACCACTCTGGGTGATGGCGCATCTG
CTCGGCCAGTAGTGCCGTGCGGCTCATGAAGCTCCAGGCTTCATTAAAGTCGTTGAACTGGAACGTGCGTGTGAtGGCGTCGCGGTTCTCGACCAGTTGC
CATGCGCTGCTGATCTGCTGCAGCGCCTTGGTGCGCTCCTCTCCACTGAGCTTCGTAGGCACGGCGCTCATCCAGCGTTGGTTGTGCGTCTGCA