Description :
From Genome Similarity Track
Location :
Scaffold_359:1056- 5709
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_359-snap-gene-0.10Ketohexokinase
Pytir_DAOMBR486maker-pir_contig_359-fgenesh-gene-0.7Lipase/serine esterase

Sequence
4653 bases(100 bases per row)
TGGTGGCTGCACAACTTGGCTGCTCGTGCCACTGGGTGGGGACAACGACCGACCCCGAGAAAGACACCGAGGCTGCTTTCGCGCACGCTGAGCTTGCGAA
GTTCGGCGTCAACTGCTCCACCAGTACGGTGCTGCTGAGTGGATCGATGCCCATCTCGGTATGAGCACCATATATACATTTGCATGCGCTCGCTTACATG
ACATTGTGAGAAAGCGGTTCTAAGCTTACAAACCAGGACTTGATCTTCTCACTTTTGAATGCCACAATTATAATAGTACATCTTGGCGAGCAAGGCCACC
GGCTCGCGCACCATCGTCCACTCGCGCGACCTCCATGAGCTCACCGTCGACGACTTCAAGCTCGCTACAAGCAAGCTGTTCAACCAAAGCGAAGACAACG
ACGATGCCCAAAATGATGGAGATACCGAACGTGCCAAGCGCGGCCTGTGGTTCCACTTTGAAGGTCGCAACATGGAACCTGTGCTTGAGATGATGCAGTT
CATTCGCACGCACGCTCGAAATTCCAGGATTTCGGTGGAAATCGAAGCCCTGCGATACGACTGGAAGCTTGCAAAGAGGTAGGATTTGTCATGTAGAGCG
CTCTGCCGTTCGCTTGTTCGACCAACATCAACTCTAACTCTCTGCTTCTCCATGTGATCGCTACATGGAACGACATTGTTTAGACTGGTGATGACCTCAG
ATTACGTGTTCGCGTCCAAGGACTACATTCGCGACAACCTCGGCTACCAAAATGCCGAGTCTTTTCTGCAAACCGAGTTCAAGGAGAACCAAATTGAAGT
GGCGGGGAAAACACAGTTGAAAGCTGTGATCTGTCCGTGGGGAGCGGACGGTGTGTACTACTTGCGGCTTGATGAACCTGGACAAGTGCAGCGCATTGCG
ACGAAAAGCCTCGATCGAGTCGTCGAGTCGATTGGCGCGGGGGACACATTCATCGGCGCAAGTGTCGCGGCGCTCTCGCACAAGTTGCCACTGGAAGCGT
CGCTCCAGCTGGGGTGCGAGATTGCAACCCAGAAGTGCTTGAACATTGGATTTGAGTTTTCAAGCGACCGACGCGACAAGTGGATTCGCTTCATGCATTC
GCTGAAGAAATGATTGAGAAGGGTAGGTCCGACACCTCATTCATGGTGAACCAAGCTCGCCAAGTATGTTTCGCTGAAAGTAGGCAAATTGATCTGGAAC
CCAGTTCTGTTAGATATGTGTATTTGTGCTTTTTTCTATCTACAATATGCATGTTTGAAAAATGTCATGGACTGGCTTGAGGCGTGCTCGACACTGACGA
AGGGTTTGAAGGAGTGGCCGATTCAGTCGATGCCGACGGGGTATTCGGACCTGCTGATGCTGCCACCGTCGTCGTTGGCGCTGGAGTTTCCTTCTTCTGG
AATCGCTTGAGGAGTCCATTGAAGCCAGCGTTGATTGCATTCTTTGGCTCGCCTTCCCCGCCTTCATTTTTACTCGTACTCGGCGAAGGCGACGGTTGCA
CACCTATCGCTGCTGACGCCGGAGAGCTCACCGTCAGCGAGTCTTTTCGCTGGAATCTCTCCATGAAGCGAGTCACCCCTGTGCCGATGAACGAGCTCCG
AGGCTCTTCGCTATTGCTGGCCATTTCAGGGCTTTCCGTACTCGAGGGTGAGGGCTGGCTGACATCTGAGAACCGCGTCGTCGAGTCAGAGCGTTTCTGG
AACCGCTCAAATATACGAGAGATCCCCACGAACGAGCCTCGAGGCTCTTCGTCGCCCGTAGCGCTACTCTCATCAGCAGACTGGGCATTGCCACCAGCGT
CCGATGATGATGCAGACGCTGCTTCAGGCAACGGATCCATCTGGTGGTCGGTTCCAATCATATCGCAAAGCAAATCGATGAACTCGTCTGCGCGACACCC
GGGTGGCTGCATCTTGTTGATCGCCCAGTCGTGGAGTCGTAGCTTACCCTTCACGCCCAGCGGCTCCACTGTAATGTCAATGCGGCGCCATGGCATCGCT
TGCTGTAAGCTCTGGATCATCGAGTACGAGAACTCCACCTCCTGCTTGTTGTCTGCGTCGTAGTCGTCAACACTCTGATACCGCGGACTCGCTGTGACAT
CTAGGCCAAGCGTGAACTTCTCGATCTCGACGGTGTGGTCGACCTTGTCCTCGAGCTTCTTGAGGAAAACCGCGCGCCTCTCGTCGTCCCCATCACCACC
AGACGCAGTAGCGAACCCAGAGTGATGCACGTGCCACCGCCAGTCGGTGAATCGGTCGGTCAACGAGTTGCTCGGGTACGGATTGAAATTGCGGATCGAC
GCGGACGCGTACGGCACGACCACGTCGCCATCCGTCATCGCGACGAGCGTACCGAATCGAAACTGCTTGAGCGCACTGAGGAACTGCATATCTATAGAGA
GAGGCGTGCACACACAAATGTTAGCACAAGCAAGGTATCATACCATTCCCCAATCCTTTTCTAGCTCGTACCTGGGTTGCACATGGACTCGAGCAGTGGC
GGTACGGGGGTCGTGTCGACTTGTGCTTCTGCCTCCACGGTTTTCTTGCAATCGATGAGCAGGTCAATGCCAGTCTGGCCGTAGATCGTGTTCGATCCAA
GCACAGTGTGCACGCCCATGCGCCACACATTCTACAGATAAAGAAAGGGGGTCAAAAGTTAGCTACACTTTCTACCAGAGCCAAAGCAAGACTGGATGCT
CACCTTGAGCTTCGAGTCGCCGCGCGGTCGTCGAGAGCCGAGGTGCGGCGTGCAGATCGTCACGAAGCTCACATAATTAATGTTGAGCGGACTGAGCGAC
TGCATGAGCTGCACGATCGCAAAGCGCGAGTATAAACCTCCAAGCGAGTGGGCGATCATCGAGAACTTGTACGAGTCCACCTCGGGATGCAGCTCAAACT
CAAAGATCCGCTGGCATACTTCCTCCGCGAGCTTCGTGCCTCCAACTTCCACACCGAGTGACGTCTGCGTGTGGTTGATCGCCGACTTGATGATCAGCAC
CTGGGACGCACCGAACTTGCGCAGCAGCGCAGCTTCCACCGCGTCAAAGTCCGTCGGCGAGCCGTTGTTGCCGTGCACGAGCACGACAATGTGCGGCGGC
AGGAACGCGCGGCCAGGCGCTCCATTCGTCTCAGGTGTGCGCTGTTGTTCGATCTGCTGGCGCTCCTGTTCTTGGTGCTGTTCAGCGACGCTCATGGTGA
TCGCGCTGCTCTGCACTATCCAGAAGCCGGGGGTGTAAATTCGCAAATGTGGCGCTGCTGTCTATACACTCACAAGTCTCAAATGGCTACCTAACCAAAC
AAAAAGAAACACCAATGCGAAAAGGTCAGCGTGAGAACAGTCAGCTCGCATGTGTGCCCCCCTCTCTCTGCCAAACGAGGCACTACGCTAATGCGTATGA
GAGAGTATTTGTTGTACCGGTAGCACAACGTCAACTCGTCAATGCGTCCGTCGTGTCGCGGGCGTTCTTGGCCGGCTGTGTGCGGGACAAACAGTAGGAT
CGACCGACAGCCAGCCTGATGACGATGAGAATCAGCTGCTGTTACCTGCTGTCGACGCGGCTGGCGCAGCTCACTCCTGAAGCGTAACGAGCGGCGTTAC
GGAGAGCTCAAGCAAATGCTAAAGTGAAGTGCTGCGTGGACGATGACGACGTTGGTGCGGAAGAGAGAGAGGTAGATAGAGAGTGGCCCTGCTTCTGCTT
CCTGGAAGTGAAGCCAGGAGCTTTAATCGATGTGCGGCGGTTCTCAAGTGCTGAGCTCTTGACGTTTTTTTCTCAACAGTGTCTGAAGAAGGAACAAAAC
TATAAGTGGTACACTGTACCAGCAGCCACTATTTTCATCTAGCAAGTTGATTCACTTTTGCTAAATTGTATAAACAGTCGATAATTTCAGATTTCTTTGC
AAAAATGGTCTGCAAACAAATTTATTTGTAATAAACAGAATCAGGGATATAAATTTAAAGACAAAACTGTGTGTTTTTGACTCATGATGAGACCTTACTG
AAATCAAGTGAACTCTTTGGCCAGTTTTGTGGTAAACATCGCGCAGCGATTGGCTAAAATTGCACCTTGAATTAGTGAACGCCGTGCAACACTTCGTCAC
AGCGCGAAACGCAGCTGAGGTCGTATTGACACATCCTTCTTGTAGCTCATAAGGCGCATCCAAACTATATATTTCACGCATCCACATATCAACCAGTACT
CTTTACAAAACCTTTCTATCGTATCAAACATTTCTACTAGCAGATACAAGAGGTCCGTCCATATGCTGTTCCAGACTTTCAGACCATACTGATCGCCGGT
ATCACAGACTTGTACTGAATGGCTCTATGGAAAAACAGCAGCATAGTGGGAAAGAAGGCGGAAGGAAGGGAAACGAAGTGAGATCTCCGCATTAACCCAC
CGACACGAGCGTTAGTGCATCCATTAACTCACGCACGCACGCGCGCCTGGGGAGCACATAGATACCATTTAGATAGATAGGCACGTGGTTGGTTGAGAGA
GAGAGACATGGACGACGGCACGCGCATCAACGTGCTCATGGGCGCCATGGCCGCTGCCGTGTTCGTGCTCTTCTGTCTGATCGTGCTCTGCGCGCGCCAC
TGCCGCTCGGACGAGCACGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCA