Description :
From Genome Similarity Track
Location :
Scaffold_63:105552- 106632
Transcript NameFunction/comments
Aphas_H257_15082cytosolic regulator of adenylyl cyclase

Sequence
1080 bases(100 bases per row)
CGGGGTACAAATCGTCCGCTGCACAACTTTAGCATGCAAAGTCCACGAGACAGTGCGCGGGAAATGTTGGTGTACGACCTCAAAGTGCACCTTGACAACC
AAATGGACGACCACACGTTTCGGTACAAGAACAACCACCACTCCACCGTTAAAAATATATATTAACTCGATATAGGGACCTTTTGATGCACAAGAGCCGA
GTCTTATCCGGAAAAGACTGGTTCCGGTGGAACTGGGATATTATTTCCGAGCTGCTCGAAGGACCGCTGACCAACCCCGCGCGGCTCTCGGAGGCAATGA
AAACCAAGTTTTTCAAGCGCGTGTCGGGGTTTTTTCGATGTGACAACAGCGACAAAGGTATATTATATATATATTGTATTTTTTTTATCCGTATTTTAAT
GAAATACGATATATTGTTCTGTAAATCGGGTATATAGTAAATCAGGTATATATACTTCTTATATTATAAATCAGGTATATGTGTATATATATACATATTG
TATTACAAATCTGGTATATATATTGTTTTTTTTCGTCATTCTACGCAAAACTGTATATATCGTATATATATATATATATTTATGACTCCTTGTGGTTTTC
ATATGGAATGGTGTGGTGTAGGGTACTTTGCAGGGCTGCCGTGGACGCCCGACTACGTGCCGTACTTGCGTCCGGCGTGTCAAATGTACACGCTGCTGTT
GAATCATCCCGAAGGCATTGCGTTCTTGAAGACCGATCGACGGTATGTAATGTTGTTGTGGAGTTTAATATTGCATATTTGAATATATATATATTCTATT
GGATAAGAGACCATGCGATATATCAATGTTTCCATGTGATTTGATATGTAGAGGGCAATTGCTGAATGAGATTTCTACCGCATTGGAACTCGAAGCCAGA
CCGGAAGCTGCGATCGTCGAATCGCATTTGGGCGAGTTGCAAGCCAGGATGTTCAGGTACGTACCCTTCTGCTTGGTTGCATGTATGGTCGAATATGATA
AATATATATATATCAGTCCGGAATATTGCTCGCGACGCATGCTTCGCGAATACTTTACGCTCTTGGGTCTTATGAGCTCG