Description :
From Genome Similarity Track
Location :
Scaffold_2:105549- 110813
Transcript NameFunction/comments
Phypl_g82protein kinase
Phypl_g83hypothetical protein

Sequence
5264 bases(100 bases per row)
GAGGCGGAGCGCGATGGGACCAGCTGGTAATGGTTCTTCCTGCATTGACCGAGTTCATTCGCAGTattggcgcagcaggccatTTCTCcggccggcgacg
gcgacgcgctcTCTCTCAGACAAACTAGCAGCAGGGGCAGTACGAACAGCCGAACatgacggcgacggaggacgcgctggagacggcgcgcCTCGTGATC
atctccacggccgccgtcatctcgtctgtcgtggccgtcgtgctcttccgcCGGATACCGGACCCAGGCtacagcacgcgcgcgcggaGCCGAggacgca
gccgcagccggaagccgccgctgccgccgccgcacgcGACGGGCCCCGCGCTCTTCTACTCGGTCGTGATGACGGACTGGTTGTTCTCGGTCACGGGGGC
GGTGAGCCAGTCCATGGACATGGTCATGGGCGCGGGCGTGAAGGTGCGCACGGTGATTGGCGCCAGCGTCGACTCGCTCTACCACGTGAGCTTCctcgcg
tcgctgctctggggcgtcgtgctcgcgGTCTTCGTGCTCAGGACGCACCGCTGGGCGCACGGACAGCAAGCCACCAGCCCGCCCATGAAGAGATTCCCGG
TCCGGACGAGCTGGCTCACGATCTGGACGATGGGACTCGCCAGCGGCCTGCTCTCGACGGCGCGGCTTCAAGCGCTCGTCACGGCTAGCGACGCGGCGGA
CACGCTGGCAAACTGCCAGCGCTACTTGTACCTGACGGTGTACGCTCTATCGGCAGGCTGCGTGGTTGCAGCCAATGTTGTGCTGTTCGTTCAGAGGAGG
CGGCTGAAcagcgtggaggagctggcaccCAACCCGGCAACTGCAATGACGGACCCTTCGCTCGGCAACAGCGCGGACAATGCAGCGCTGGTATCTACGA
AGACGTGGGAGATGCAGGCTCAACAGGCGCTCCGGATAGCGCACGAGAAGCTCATGCACTACTTTCTGgtggtgcaggtgctgcagttccCGATGATGCT
CTGTTACATGCTTGGACATGATGTGGTGAGCTATGTCACCTATGAGGTGGCGGACTGCTTATTATTCAGCATGCCGCTGTTCAACGCCATCGTGTTTGGC
TGGCGACATCTAGGAGAAGCCAGGTTCCCTCGGAGTGTAGACGATCTGCGAAACCACGGGACCATACTGCAGTctagcagcaacagctcaCGTCACGGCG
AACGTCAGCGAGATCGCATGGGGACGGGGATCTTGGCTGGCAGCGGTAACAACGGTGCTGGGAATGTCCTAGCTTCGTCGTTCCGGACCGTATttggcag
cagtgcagcAAGTAGCACTAACGGAAAGGAGTCGATGAAAAGCACGTACGTGGGCAATGAGGTGGTGGCTCTCGAGGAGCTGAATGGACTGTCGAACGTG
TCGTACAttgctgaaggagctgctggcagtgTGTACAAGGCACAGTGGCTAGGCATTGAGGTTGCCATGAAAGTCATCAAGCTGCCTAATGGAGGTGCAG
CTGGTGTGGTGGATGCAGAGCTTTACCGTACTATTATCCAGAACTCAGAGGAGGCTTTCATCGAAGAGGCTAAGCTTTGCTCTCGGCTGCGACATCCAAA
CATCACACTGTTCATGCGCGCCGGATACTTCGAAGGCAAGCTGGGAATTCTGACGGAGTACTGCTCACGAGGCAGTCTCaaggacgtgctcaagcggcAC
TTCCGACTTAGTTGGCGGCGCAAGGTTGCGCTGGCCCTTCATATCTCGAAGGGTCTAACCTACTTGCACGCGCGCAACCCGACGTACAtccaccgcgacc
tcaaggcGTCCAACATTTTGGTCACCGAGACGTGgcaggccaagctggccgactTCGGTATTTCCAAGGTATCGAACTTTGTCAACCGTGTGAGGTACAG
CGAGCGCACTGTCAGTTTGGCAGAGCAGAATCCCAGTGTCTCGGATGAGCTGACATCGTTTGCCGGCACGTGGCGTTGGAATGCTCCCGAGATCTTGCAG
GACCCGCACAACTGTCGCTATAGCCGTGCAACGGACATGTACTCGTTCGGCATGGTGCTGTGGGAAATCGCCTCGGATGGTGCTGTTCCCTTTAGCGACA
CGAAGTTTGATTTCGAGGTCCGCGAGAAGGTGCTTGTGGAGCAACGTCCACCGATTAACCCTGGACAGCGCTGCCCTCGGCGCTTTGCACAGCTTATCGA
GGAATGCTGGGCGCAGAATGCTGCGCTCCGTCCATCGGcacctcaagctgctgagaTTCTCAACACTATTCTGGACAACATGTCGAAGGACTCGAACGAT
TTTgccacgatggcgtccgTGTCGGGCTCCGAGTACACGAACAGCATCTTCTCGTCACTGCGAAATGGCGATGGCTCTTCGGACCTGGACCATCGACCCA
GCTCTTTCCTGGGCCAGCGCATTACGAACTTCTTCCGCGGTCGGTTCTCGGCtcgtagcagcagcagcagcgctatGAGCGAGGAATACCATGATCACCA
GGACAACGAGCACTTCTACAAGTTCACGTCTCCGTATGCTGGACCAGAGAACATTagcgtgctgggcgcccGAGGCAGTGCGGCCGTGGAGTACAGTCCG
GCAAACTACGAGACATCGGGTCTGCCCATTGTGGGCCTTCCGAGCGACAGCCGCCGCGGCGACGGACTGGTTGGCGGTCGTCTCTCATCGCTGGATGAGT
ACGACTTCGAGATGGAGGGCAACCCGTCCGACGTGTCGACGACGTACAGCAGAAGTCCGTCTGTGGGCGGCAGTTCCTCCATGCTGCCACCGTTCCGCCA
GGCCCAGGCCACGAATGCCAGGCGCGAAGAAGTCCGACCAAGTGAAGACCCCCGGCCAAgcgaagatgaagccgaGTTCGTGCTCGGTGCCAACGGGCGG
ATACGCCACCTTCAGTACTAGAAtcgcgcgagctgcaacCAAGCCGCGAGCGACAAGCGGGTCAAACCGCTGGTATTTATTAGCCACGGACGAGGGTGGA
AGCGAGTAAATCGCTCCGAGGAACTCGCCTCATTACGGAGGTACTGGAGATCTCGTACTACAACTTGTAGTCTACAAGTAGGGTAATAGCTACACAGCTA
ATCACAGCATGAAGTTTCACTGTTGTGGTGTCTATCAAGGCTGGACGAGCCGAGAGTTCCTAACGTCATTAGCATTGCTTTCGTACTGAATAACACGACT
ACATTGGCGATCCGTTTTAGCTTGCAACGTGTTGACGGCGTTGGTGGCTGTGCTACACTTCGCGACGCAGGGAGTGCTAGCACAGCACAAGTAGCAATAC
TAGAACTACGCACTAGTAGTATGCATTTGATGGAGAGCATCAGTCGTTTAGTCTTAGGTTGGTCTCATCGAGGCCGCTTGTTCAGCGGATTCGTCAGAAA
CGAGGAATTCACTCTGAGCAGACCGAAGTCCGCTCAGCATGAAAGACATCACACGCCACTCCAGGGTACAAGGAAACAGATCTAATtctctgcgctgctg
ccaacgcCAAGTGTACTGCACAAGGGCAAATTGAAAACTGAACTGCCGCGCCGCAACAACAAGTCGGAAGCGGTGCAGTCCATCCATCTCAAAACCTTTC
TGCTTACATACCCCTATATATCACACTACATATGTTCTACTACTACCTGCGTTATCTAATCCACATTTGACTGTCCGAAATGCTGCGCAACGCTCGATCC
ATCGGCGTGGCTGTGGCGACACTGACGCCTCTGGCGGCGTTGGCAGTAGGCGAGGCATCGCAGCAAtacgacaacagcaacaggGTCCTGTATgcaaagc
agcagctgcagaagtggcgcagcgccttcgaAACGGAGCAAAGTACCGAGGACTCGAAGGCGAACGGGATTGGCGCATCCGCTTGGCTGGGCAGTGCACC
GCCCAAGCTCCCATACTTGCTGTCAATCTCTGCTGGTGATAACCCGGCAGTCGTCACGAATATGTACGTGCTCTGATTGCTTGTGGAGTtcgagcttctg
catctGACGAGATATTCTGGAATGTGTGCAGACTTCTGGGAggcgccaaggtgctgggGTCGTACGACGAGCCAACGCGCGACACCCTGGAGAGGCTGAC
TACACCGACGTCAGCGCTGGGATTTGTAGTCCACAAAATTGCAACACGTTACTCGACTCTGAAGACTGCACTGCATGGAAATGTACCACCAGAGTTTGAT
CCGCGTGTCGGAGAGAAAGTCAACGCGGAGGATACGATGATGGATGCGTTGTTGGATTCACTACGAGACTTACAGAATAGTGAGCAGCGAAGAGAAAGTG
TGGGTGAAGAGAGCGGAGCAGGTGCATCGGCAAGTTCGCCGACCGTCGAGGTTACTAAACTTCCTGTGTTTTTGCTGCGGGACTTTGACACCCTTAGCGA
CCAGGATGCCGAGAGGTGGCTGCGGTGGACGCATCAAGTATCGAGTGAGGGTTTAGCCCACGTGGTACTGCTAACCACTTCGACGGTAACACCAACCAAG
GTACAGTGGATTCAGACGCGCCATCAAAGCGGGTTAAGCGGCGGTGCTTCGGAGGGCATCCATGACTTTGTTGGCATATTGCTGCGTCCTGCAAACAGTC
TAGTCGATTCTACTTCAGCAAAGGAAAAATTGCAGAAGCTAGCGGTACGACACAATGAGATGTTGGCTTGTTTAGATAGACAAGGGCTGATGCTTGCTTT
TCTTACTGGTGATTGCAGGATTTACACGATCTAAACTCGTTTGCTGACTCAACGCAAACAAGTGAGGAACACACCAGCGATCAAAatgatggcgatgatg
cagACGATAGGAAGCATGCTACAGAGCTTGAGTGCATTTTGAAGACAACCGGGAACTGGTGGAGCGATATCGACGAGATTTGTCGGCGATTAAAGGAAAG
CGAGCTAAATaacgtggtgcagcacgaagagcgaCTCGCGATCATCCAAGAAGTGTGCAATGCCTTTGTCCAAGACACCGAAATTGGATTGCTGGAAGCA
CTGCATTTGGACGGAAGCCTGCAGTACCCTCGCCCAAGTACTTACGGGACAGAATCCTTACCGAGAGGTTCTACACCCGACGTCACCGACACGTCAAAAG
CTTTCAGCGCATTGGAAACCTGGAAGTGCCTCGAGACGTTGACTGAGGTGACTCCAGTAACAGGCGGCAGCTCTCTTGTTGGCTCACCGCAACAACTTTT
GGATCAAAAAGACAAGACGCCACTGAACTGCGTGAGCCCAGTCGAAGCGCTACTGCCGTTTAAC