Description :
From Genome Similarity Track
Location :
Scaffold_2854:1055- 2423
Sequence
1368 bases(100 bases per row)
TTGAATCCGCACAACAGCGTTCCGCAATTCAGCTGAGACATAGGCAACCACGCAGGGTCAGGATATCCTTTCCACTTCACCAAGAATTCTCGGACTCTTC
GCGAAGTGCGTGTTCGTTTCACCCATCGGACATCTCTGATCGCTTCCACTTCATATTCATCATGAACTTCGTCAGGTCCATCAACGTCCTCAGGTAGCAA
CGCAGCATCAAAATCATCTTCCTCAGCTACCTCCACTTCAGCTGTCGGTCGGTCTGGGAAGACTGCACGTGGTTTGAGTCGACTAACGTGGACCCACGGA
TACAGTTTATACCCAGAACCTTCAATCCTCAGTTTGCAACGGAAACCGTCTGAGGTTTCCATGATCCAGAACGGGCCATGCCACAAGTGGGCGAATTTCT
TGGTCAGTCCGGGTTGAACTCGTGCTAAATACAGCCAGACAGCGTCTCCGACCTTGAATCCTTGCTTGAGCCTCTCAGACAATCCTTTCCAGATTTTAGT
CTGAGCTTCTGAGCGTTTCGACTTAGCCTCAGCTTGGAGATCCTTCGCTCAGTCTTGAGCGTACTCGTACTAGCGTTGAACGTTCCGGCGCCACTCATAC
GCAGTCCGCTGATCCAGCCCAGTATGAGGAGCACCTAGCATAGCTGACACCGTACTCTGAGGGTCCCAGCCGTGAACGAGGCAGAACGGGGTGTCTAAAC
GAGTAGCGTCGAAGGACGTGTTCAATGtccacatcaacttctcTGTTTGGTCGTCCCAGTCACTTTGATCAGGCTCTGAGACACACGCTCGTACAGCTCG
GGCTACCGTCTGCACAGATCGCTCTTGCTGACCGTTGGCTTGAGGTCGATACGCTAAGGTGGCTCGCTGTTGACTTCCAAGCATTTCACGAAACTTGGTG
AACACTTCGCTCATAAATCTCGGATCTCTGTCGTGACGAAGCATGGCACTTGCTCCAAACCTCTGGGATACACACTCCATGtatgcttcagcaacttcct
gGGCCGTCGTGGTACTCATGGGTTTACATATCACAAATCCGGAGAACGAACACTGAAATAGCAGCAGAACGACGTTACATCGGTCGGCCTTGGGTAGATG
CGTGACGAAATCCATGGAGACTACCTCAAATGGACGTGTCGCCAAGATATTTCCGGGTGAGGGTCCAGGGTTCGGCGGTGCTCCCTTAGCCGTGACGCAA
TCCACGCATTCCTTGACGTAACGTTCCACATCCGCGTACATTCCAGGCCAGTAGTACTCTTGGCGTAATCTCTCGAAAGTTCGCGTGATCACTTGATGAC
CACCCTGAAAGTCTTCATGGCTGAGCTGCAACAGGTCTTGTCTGAGAGAACTGGGAACTACCAGTCTC