Description :
From Genome Similarity Track
Location :
Scaffold_23:105486- 108807
Sequence
3321 bases(100 bases per row)
TTACCGGAAGAAGCTCCGTACTGATAGTACGGCCTAAGTCGACCGACGTAAAACGTAGGATGAGTGTGCATCTTACGTGGCAGTTCAATCGTATATGCGT
TTCCTAGGCGGCGCAGCACACGAAATGGATCGATGAACTTTGGTAGTAACAAGTCACTACTCACGTTAGTCACTATTTGTCGAGGTAGGTTTACCGTAGA
TAGTAGGACTAAGTCGCCTTCATTGAATAGAAGAACATTTGACCTTCCGTTCTTGTCCGCGTTTCGTTTTTGTCGATCTACCGCCTCTGTGATAGAGTCT
TGTACGAAATGGACAACCGTTTCGCAAGCCAGTATGAAGTCATCTGCTGAGTCGCTGTCTTTAGCTACAGTGCTCTTGGAATGTACTGAAGCAAGATCAC
TTGTCGCCTCTGCGAGTGTGTCTTTGGATGCACTATGCGTGATGCTGATTAGATCAGTATCGTGGTGAGTAAGAGCATCTTCGCTCTTACTTTCCTCTTA
TTCACCAAAGCCGATATGATCAACATCGGCATCGAACGTGGTAACCGCATTTTTGTCAGCACGTGACGAATGAGGGCCGGACTGGCGATCGCTCGGATGA
GTCCTTCCCCTTAAACGAGAGTCACACTCTAAAAAGGTATGAAGACGCGGATGGTGTAAGCCATTCACGAAGAACGGCGTGTGCGACGTCGACGCATGGA
CTAAATTGTTGTGACGAACTCCACCATCGGCCAGAATTCGCTCCAATTCGTAAAAGAATGGACGTATCCTCAAAGGATCTCCTCGAGGACACGATTGGCG
CGTTCGGTCTGACCATCTGTTTCAGGATGGTCAGACGTGGACATCTTTAAGCGCATTCCGAGTGTTTTGAACACGGAACGCCAGAACTCAGCTGTGGACC
GCGGGTCCCTATCGGACACAAGTTTACGAGACAACCCATGAAGGCGAAAGACCGTGTCGATAAAGACACGGGCACAAGCCGACGCGTTGATTGTTTCGGG
TACAGCAACTAGATGTACCATCTTACTGAACCTGTCAGCGAGCACAAGAATACCAGTATTCTTGTGAGAGTCTGCGGGTAATCCAAAATTAAAAGTGCAT
TGAGACGGATTCCCAGCACTCGATCGGGACGGGAAGACGCTGCAACGGGGCTCGAAGAGAAAGACTAGAAATCACCGGTGGACAGACCTCACAGGCCCGA
ACGTACTTGCGCACGAACTGATACTGGCAGGGCCAGTAAAAGCCGCGGCTTACTGTGAGATATGTTTTCTCACGACCACGATGTTCACCAACAGGTGCGT
CGTGGTACTCATATATGATACGCAATCGCAGATCACCATGATCTGGTACGACGACACGAGGCGTGTTGCCGGCAACAGCCAAATTTTGGAATAATCCGTT
GCGAACTGTATATATATCTGTAGAGGATCGATATACTGACGACAACTGTTTGAGGCTCTACCCGGATGGGTGCGAGAGATGATGCATCAATCGCACCATT
CACGGATTATGCGACTTTCGTATGTCTTCCAATAAGGTTGACGACGGGACACTCGAAGTCAGTACCACGACATTGGTCGGACCAGTGTCAGGTGGTGTAG
CCGGCTCTAAATCGGGCCGGCGCGAGAGTTCGTATGCGACGACGTTAAGTCGTCCTGGCTTATAATAGACGGAGAAGTTATACTGCGCAATAAATGAGAG
CCACATCGCCATCCGCTGCGAGAGGTGTGGACTGTTTACGGACGTGCGTAAAGACGCATGGTCCGTATAAACGATGAATGGTCTGTCACCTAGCAGGTAG
ACTTTGAACATAGCCAGCTCGTACTTCATATTAAGGAGTTCCACGGCCGTGGACAGCTGCGTTCAGCTGGTTGCAGCTGGCGTGACTGATAACAGACGAC
ACACTCCGCTTCATCTGCATCGTATTGCATTAATGCGCAGCCTATTGCAAAGTCACTGGCGTTACAGACCACGTGGAATGGTCTAGCGATCTGCAATCGC
CAAAACTGGCTATCGTATCAAGCTTTGCTTGATACCTTCGAAAGAGCACTGACAATCGGCACTACATATCCACTTCTCGTTATTTTTCAATCAACGAGAG
AGACGAACAGTCATCTCGGCGTAATTGCGTGAATATTTATGCAAATACGCCGCTAGTCCAAGGAACTTCCGAAGTCCCTTGGCATCTGTAGGCACTGGCC
AGTCGGTGATCGCCTTGATCTTTCCGGATCGGGCTGGACGCCATGCTTACCCGCGATACAACCAAGAAGTGGTACTTTGCTAGCAGCAACGATGCACTTA
TTGAGGTTGGCGTACAACTTATACTTGCGCATAATTGTAAAACTTTCTCGACGCGGAGTCGGTGCACTTCCACATCCGTCTGTCCATCCATAGCCCGGCC
ATAGACAAACACATCATCGAAGTAACTGGGCAAGAACTCTCTTACGGATCTTAATAGATTCTTTACACATGTGTTGAATGTGGCAGGGTTATTGCTTACC
TCTTGTGGCATTACTAACCACTTCCAAAGCATACCGCTTGGGGTGATCACTGCAGTATAGGGAATGTCCCTTTCGCGCATAAGGATCTGATAGAACTCAA
CCATCGGATCCATGGATAAAAATATGGTACTCTTTTCCATACCATCTATGATGACATCTTTCCTTGGTATTGGTGTTTGAGCCGGTACAGTGGCAGCATT
CAACTCGTTGAAGGCATGTACTATCCGCCACCCTCCTGTGACTTTTCGAACACAGAAGGTCGGAGAGCTATGTGGAGAGGTGGACTCCCTCAAATGGCCA
CCTGCTAAGCGATCTGCAAAGAATTTGTCAATTGCTAGTACTTGTTCACATAGAAGAGGCCATCACTTTATGACACAGTACTTCGAACCCGGTTTCAGGT
CGATTTCGTGACGAGCAACTTTTTCCTTAGGTAACTCGCACGGGACTGCTTCTGGGAATACATCCCTGAATCTCATCAAATCGTCGTAGAGAGGATTTTC
TTTGAGCGATTCCCACGATTGGGATGTATATCGATCAATTTGGGTCTTCTCATGAAGGACACTCTCGTCCATTGATGGAAACTCTTTTATCCTCGGCAAA
GACCATTGCCGATCGGATATCACTGACGTACTCATCCTCCGCGACGAGTACACAGATCTGCTTGATTTTGACACTACGCAGATCACGCAAGAACCTCTTT
TGGCTCAGCGGGGTATCTGAGTGATCTCCGAAGTCAACTTCGGAGGCGCGACCAGATCAATTGTATGACTACCTATGCTTGATCCGTCATTAACCAGGAC
ATTTAATGTCTCTGTCATCTC