Description :
From Genome Similarity Track
Location :
Scaffold_70:105486- 106540
Sequence
1054 bases(100 bases per row)
GTCGTTCCTCATGATGAGGATCTCAAGTATCGAATCCTCGATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTACGGCTCGG
TGAGCACGATGTACTGGTGGCCCAATATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACGAAGTCCGCGCCGAGCACGGC
AGCGCCATTGGCGAGTTTGCCTGTCCCCAAGCGATGTTGGTAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGATAAGGCGGGAAACACGGGT
ATTGTGGTCTTTGTAGACCGATTGAGCAAGATGGTTCACTTAGCGGCGGTGCCGGACACCATAGATGGTAAAGGTACAGCTTTACTGTTTTTAGACCGAG
TCTTTCGCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCCGAGTGCTCGGCACTCG
TTTGGACATGTCCACAGCGGACCATCTGCAGACCGATGGTCAAATCGAACGCGTGAATCGCGTTGTGGAGGATATCCTCGGAAGCGTATGCGCTGAGGCG
CCAAAACGCTGGAGCCAGATGCTCCCACTCGCTGCGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAACGGCTTGG
TGAACCCTCGCATCCCACTGACGCCCGCCACGCAGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCAGTTGCGGTTC
GCAAGCAAGTCAATGACTATGTCTCTTTGAGACTGAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACATGCAAAAAGAACATGCAGA
TGTCGAAGGCAGACGCAATGAAGAAAGGTTTGAGGTCGGAGACCAAGTTTTATTAAATGCAAAAAAAACCTACCTACGCCTGCAGTGTCTGCAGTCTTTA
AGAAAAAAATTGAGACCACGGTTCATAGGACCGTTCAAGATCGTGGCCAAGAAG