Description :
From Genome Similarity Track
Location :
contig_2:1054699- 1056711
Transcript NameFunction/comments
g817.t1ETL43144.1 hypothetical protein L916_06280 [Phytophthora parasitica
g818.t1KUF92267.1 Lysosomal thioesterase PPT2-B [Phytophthora nicotianae

Sequence
2012 bases(100 bases per row)
CTCCTTCCTGGCTTGGCGCGCAAGCAGTTTGGCAGCATTGAGCTGGCGATCTGCTCTCTTGACTGATCGTCTTCTCTTCGATCTGAGATTCGAGAGCTGC
AAGCTTCTCGGTCGTCGCTCGGGCATTGGTTTCGCGTTCCTCTTGTGAAAGAGCTTCGAGTTGAACGAGCTTTGCTTCAAGCTCCTGGACACCATGTCGA
CATGTCAGACCAAAAGAAACACAATAAAGATGCAAGAAGGTCACACCTCAATCCTGCTGGTTAAGAGAAGCTTTCGGTCCTGCTCCTCTTGAACTGCGAC
TTGCAACTCGTGCGCTTCCTGCTGCAAATGACCTGTAAATGTGACGATAAACCAGAATTTAGCGTTGCACTGAAGATGAACACGGTAGACCACGTACAAT
TCTTCTGCTGAAGAGACGCAGCTTCAGCGTTTGCACGAGCAACTTCTTCTTCAGCAAGCTTCTTCTCCTTCTCAAGCAATCGCAATCGCTGGTGCACTGT
ATCGCGGTCGCTCGACCATTTTTTCTGTTGGTGCTCTAGCTCATCTTGTAGCTCCAGCTCCCGAGAACGCAAGGTCCGGATGAGTTCTAGCTGTTCTAGT
CGCTCCTCGTCCTTGGCACCTGCGTCTTCCATGCTAATGTCACGCAAGAACTGAGCTTCCTCTTGCAACTGGAGGTGCTTCTCCGCCAAGTTCTCTTTTT
CGTGCACCAGCTCCACGTTTTCCGCCTGCTGGCGGTCGAGTTGTTCTCTCAGCAGTGCGATCTTGTGCTTCTTCCTCACAATTTGATCCTCAAAGCTACC
GCACGTCAAGTCAGACAAACACTCCAGTAGCGGACACTACGCCACGTACACTCTCAACTTGTCGAGATCAGCATACAACTCGGCCATTTCATCTGCTTGG
GCATGGATAGTGACCGCTTTGGACGCCAACTCCGCTCGAAGCTGCTCGATCTCCTCGTACAACGCTGGATCTACGAAAATGGTGAAAGTTAGCAGCGCTA
CGGAAACATTCTAACGAACTGCGTCTCACTATTGTCAACTTCAGCAGGAACTTCTTTCTCTTCGGTTGCGTCCTCATGCTCCTTCTCGTCGTCGCTCTGA
GGCTTCTCGTCTTTCGCTGCAGCATTGCGTTGATTATCCTGTCGCAGTTTCTCCACCGTCCGCTGGAAGTTCTGTCCAAGCGCCTGGAGTTCATTTTCAA
GCTCCTCACGCGGCTTGGGACGAAACCTCAGTGGCCCTCCGACAGTTTTCTTGAGCACGAAGTCGTTCACGAGAGCTCGCGAGTCTTGGAAACTCGGGGA
TCTTCTCCTGGAGCGTCAATTTCAGAACGTCAATGAGCAGCTCTTGCTCCCGTTGTTGCTTGCGCAGGTCCTGGATCAACGCCGACCGACGATGCTCCTT
TTCTTGAGCTTTCAGTCCTTGAAGCTGCTCTTGTAGCTGGCTGATCGACCGCATCAAAGCGCGCACTTTTTGCTCGTGCACAGCCTTGAGCGCGCCAACT
TTTGCTGCAGACACGGAGGAATTCGTGTGAATTGGCATCCTTGGGTGTTAGAAGTAAGTAAAAGACCTGCCTTCTACTGCCGGGTTGGCTTCCGTAGCAT
CCTGGGCAACCCCGTGCGAGACTACCAGACGTCGTAGCTCCTCCTCCCGTTTCTCCTGCCGAGCGATGGTAGCTTGAGCAGCCCGCAGAGCCTCCTAGTG
CATGAAGGATGGCAATTACTATCGTGAAAGCTGGGTTGGTTGTATTCACGTACTTCTGTGGCCTTGAGTCGATCTGCCACACTGGATCAGCAATGAGGAC
AATCTACCATGAGTGGAAAGCTGACAAGGAGGCAGTGGTGAAGACTCATTCGATGCGTACGCATTGGATGGCGTTTTCTTGGCCTCAGCACGTACAGGGC
GACGAACGCCGCTAGTGATACTGCTCATGAGCTTCTTGGTTGGTTTCGTGAAAGATGAAGGGTCAGTGACTGACAAGAATTAGGTTGACTTCTTAGCTGG
TCTCGTCTGGTA