Description :
From Genome Similarity Track
Location :
Scaffold_97:105459- 110364
Sequence
4905 bases(100 bases per row)
CTCACACGCCGCTCTGGTTCAATGGCGCACCGAGAGAAAGGTCTACGAGGACGTCATGAGAGCCCGTTGTCTGACTAGTGGAGAGGACTACGACACTGTC
ACTAGGTCAGTGAAGGACTCGTTTGACAGGAAGCTACTTGAGACTTGGTGCCGTCTCAGTGGCAAATCGCAGTTGAAGATGTCGATGACGCAAGGTTACG
CGTTGAAATCGACACATCATCAGCTCTGTGAAGAACCACACGCTCCCAGACATTCAAGCTCTTTTTAAGAAGGAACTTCGTTTAGATCTGAAGGAGAGTG
ATGTGAACGAGCGGGTATTGCAATATTTCATGTCCTGTGATCGAATCATTGAAGAGCACGGGTTACAAGCCTGCTTTGATTCGGAAACGGGAGTAAAGGA
GAAGTGCATTCTGTTGGTCGACTCAATCTCACCTGATGCGTTGAAGGAGGAGATAAGAAATGCATTGCGGTACCAATCACCGGAAGCCAAGACCAACGAG
TGCAAGTTGCATGATGTGATTTTGGCCAAGGCTTTGGAGCAAGACAGAGAATTTCGAAAGTCCAAGCGACAGAAAACCTCCGAGGACACACAGAGCGTGA
GACATACCCACCACAATAAACAAAAGCGCCGTGTCGAAACTGAACGACATGGTGAATGGAAAAACAAGAGCGATAGACGCAAATCAGACTCGCAATTTGA
GAAAAAGCAGCCAACTCAGAATGCAAGACCCAAATCGACCGCATCCGTGCCTGATAAGGGGTGTTTGAAGTGCGGAGGATCTCATTGGGTATCTAAGTGT
CCGATTGCGACTGATGCAGAAAAAAGGGACCTACCCAAGGAATACCATAAGAGCAAAGGAAAACAGAACGGGGCAAACATGAAGCGCCTGCGTGAGGACA
GCTGAAATACGGCAGGCACTATTCTTGTGAATGGTGTCCTACGAATGCCTTACTGCGCTGACACTGGGTCAACTCGGTGTTTGATCAGTTTCAGGGCCGT
GGAAAAGCTGAACGCAGCGACAGGCAGCGAAGTGCCGATAAGAAAACTGAGGACACCTATTAAGGGTCGTGCGGTTGGGGGGCATTGGGTCAAGGCTGGC
AGAGCTGTAGATCTGGCTATCCAACTTGGAACGGCCGCGGGTGTTGTGGAGCCTCAGAAACCTATTGAATGTCTAGTCATTGAGGATGATGACGAAGAAT
TTATTGTAGGCTACTTGAGCAGCTGGCACAGCCACAAGTAGATGAGATTTGTGATCCGTACGAGAATGTCGAGGACAAACGCACCGAGCACCCAGATCTG
TCGGGGATTTTGGAGCAACTGGGAACATTGGTCGATGACGCGATTCAGGCAGGGTTTCCAGTAGAGTTTCGACGAGAATTGGAAGAATTAGTGCGGAAAC
ATGACATTTGGCGGATTGATCTTCGAAATGATCCTCCTGCACGAGTACCTGCATACGAACTCCGATTGAAAGAAGGAGCACGACCGTACAGATGCAAAGC
AAGAAAGTATTCGCCAGCTCAAAGCAAATTCATGCGTGAATTTAACAGCAAGTTGGTGGAACTTGGGTGGGTGTATCGGAACCAGAGCAGTCGATGGGCG
TGTCCTGCGTTACCAGTGCGGAAGCCAGGCACATATGAGTTCCGACAGGCCAATGACTACAAGCCAGTGAATGCTATAACAGAGCCGATAGCGGGGGTCA
TGCCAAATCTCGACGCCAAGCTGCATAACGCTCGACGCAAGAAACATTATGGACTTTTTGATTTTATCAAGGGTTTTTGGCAGCTGCCACTTGCGAAAGA
GAGCCAAGAGATTTTATCTTACGCAACTGATGAAGGAATTTTCACTCCGACTAGAGTGCCACAAGGTAGTTGTGATGCAGCCCTTCATTTTCAAGCCACA
ATGGAGGGTTGTTTTGCTGATCTACTTTACGACTCATTGTTGATATGGATTGATGACCTGCTTTTGTATGCGGACACTATTGAAGAGTATCTGAAGGCAA
TGGAGATGTTGTTTGATAAGATGGCTTACTATGGATTGAAATTCAGCGTGACTAAGACATGTTTGTATCAGAAATCAGTGACATGGTGTGGCAAGGTTAT
TTCTGAGGAAGGTATCTCGCATGACCCAAAACGAGTAGAAGCATTGTCAACTATGCCTCCTCCAACGACGGCAGGGGAATTACAGCAGTTCATATGTGCT
TCGAACTGGATGAGGGATAGTCTAGTCAACTACGCCCGAGCTATCCATCCGCTACAGCAACGTTTAGATCAAGCGCTAGAAGGAAAGCGAAAAACAAAGA
GAGTAGCAGCGGGAATTTCACTGCGGTTAAGCAGCTCAGAGCTCGACAGTTTTAACCAAGTCAAACAGCTTTTGGCCAGCACAGCAATGCTGGCCCACCC
GAAGGATGAAGCGACGTTCGCTTTATTTTGTGATGCATCCGACGGGGGGTGGTCAGCCATTCTGACGCAAGTGGAAAATTGGGATGCCGAAAAAAGTGTC
ACTGAACAGAAGCATGAGCTGTTGACATGCAAAGGGGGAACATTCACTGGGGCACAGCTACATTGGTCGGTCACAGAGAAAGAGGCATATCCAATAGTGG
CAGCTTGTGACGATCTGTACTACTTATTGTTGAGACCCTCGGGTTTTAAGATTTTTTGTGATCATCGCAATCTGATATATCTGTTTGCTCCAAGTCCGGA
ATTAAAGAAGCATGCTCGAGGCAAGTTGCTTCGATGGTCATTAAAGTTGGCAGAGTATCGGTATACTATAGCTCATATCGAGGGAGAACAAAACGTATGG
GCCGATCTGGTGTCTCGTTGGGGTGGCGCACAACAGACAGCAGTTAACCGTTTCAAGAGAGTGACTCGCATGCAAGAAAAAGAAACGAAACGCCCGATTC
TGAGACCACTTGACACGGACTCGTTTGTATGGCCTACGCTCCGGGAGATCGCCAACACTCAGAAAGCACACGCTGATGGTAGACCAAGAGCGTGTACATC
GAGTGAGGATGATGTATACAGATTGACAGGGAAAATATGGATACCGGAGGCAGCAAGCAGCCTCATACAGCGACTTTTCATCGTCTCACACTGCGGTCCA
CAGGGTCATCGTGGAGAGGCTGTCATGCTGAACCACATAAAGAGAATCTTCATTTTCAACAATATGACGGAGCGAGGACGGCGGTTTTTGAGGAGCTGCT
TACTTTGTCATCATGTGAAAGGGGGAGGAGTAATCCCACGTCCCTGGGGACCTTTATTTCGCTCAGATGTCCGTAATGGAGCCATCAATTGGGATTTTCT
TTTCCTGGGTGAAAGTTTTGGTACGAGTAAGTACCTTTTGATTATCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCAGCTCGGACTATTTTTTGTGCCTA
AATAC