Description :
From Genome Similarity Track
Location :
scaffold_353:10542- 12003
Transcript NameFunction/comments
Pl_105731hypothetical protein PHYSODRAFT_294860
Pl_105732hypothetical protein PHYSODRAFT_469328

Sequence
1461 bases(100 bases per row)
ACGACCGCCGCCTGGTTTAACACCCGCAGCATCCGGTTGGGTTGTCAAAGCTGCTGCACCGGCGGAAAACGCCAGCAAGATCGAGGAACCACCGGTCGAG
GCGTTGTGGCCCGAGATGAAATCGACCGCCAAGACGGACAGTGGCTGGGCCGTCGCGACGAACGAGAGCAGCTTGCAGGCGCAGGCGTGGCCAAGCAGTT
CCACTTCATCCGACCCAAAAGATGTTGACGATGATGATGACCTGCTCACTCGTCTTGGAGTCACACTCTGATTTAGGACCCCGATTTAATCAACTTATTC
GTCAACAGATTGACTAGGCGTTTGTATGCGACTCCATTTTGTACTCGAATTTAGCAATGACGTTGACGTACCGACGACGGACCGTAATATGAGGTTCCGA
TTATTGACCAATGACGGCACGATATTCGCGCCGATATACCTCCAATCGGCGTAAGTAATGACCATATGGGCGTTTTGATTCGCTGAATCGTGCATGTCCC
ATCTCCTTTCTCGACAAATGAGGGCGTAATACTGGAGACAAGTTTGAACCGACACACCGGTGGATTCTGACTTGCTGCTGGTGCCCTCGCCATCATCTTC
TCTTCTGCGTCAAGCCGAGCAGCAGCCGGAATCCTTAGACACGTTTGACACGGTGGCCACACAGTAACAATCGCAATATGGGATGGTACGACGGTGGCGA
CGAGCTGCTGGAAGAAGAGCGCAGTGTGCGGCTTGGAGAGAATGCCCTGGTCGCAGGCATCGCGTTCGCGCTCTTCTGGGCCAACTTCGGGTTGTCGTGG
TATCTCTCTAGTCGCCGTGTGCCCGAGTTCTCAAGCTTTACAGCGGCGCAGAAGGCGGATTGGTGCTCGAGGTGCGTCTTGGTGGAAGTGGACCGTTTCA
AACCTTTTCTCACCGAGTTTGTGCATCAGGGTGAACTCTACGATCCACGCAGTTCTGGTCGTGATTGGCGTGGCCTACGCGCTGGCGGATATTAGCTGGG
CCGACGGGTTCATGCCCATGTCGTCGATTCGCGCCGCGAGCTTCATCTTCTCAATTGGTACGATAGTCAATGGGTTGATGTACGCAGAGGAAGGGGGACT
TTGACTTGCATGTTTATTCTGATATACAGCGATCGGCTATTTCTTGTGCGACTTGATCATTATCATTGTCTGGCCTGTCCCGATGCAATGGGTCTTTATC
ATCCACCACATTGTCGCTGTGTACGTACTGGGAAGTCTAAGCTGTTGCAGAACTTTCAACTTACAAGTGAATTGTCAACAGGGTCCCGTATTTCATCAAC
AACTTCATCTCGTGTTGCGCTGCATGTCAGTTTGGTCTGTTGCTGTTTTTACTCGTTGAGTTGGCGACACTATCTCTCAATGCGCGCGGCTTCATGGACG
CCCGGGACCGCCAAAACTCGAAGAATTACATGCGCTCCATCTACGCCACGTACATTATCTG