Description :
From Genome Similarity Track
Location :
Scaffold_84:105413- 112285
Transcript NameFunction/comments
Phyci_316865Hypothetical protein
Phyci_95136Hypothetical protein
Phyci_83212Hypothetical protein
Phyci_95137tryptophan synthase putative
Phyci_11405general transcription factor IIH subunit putative

Sequence
6872 bases(100 bases per row)
GGAACGCCATCACCTGCGCCCCAGCGACCATTTTGCACCGTTGAGAGCTTCAGTCGTTGTCTGCCGCGCCATTGGCGCAAAGTCGGTTAACAACTTTCCT
CCAATCAAACGCGGAGTAGCACTTTTGATCCCTGAATGATGGTCTTTAAGAGTTTTTCAGCCAATCGCTGCGCCTGAAGGTTATTGCCGCCTTTCCGCCA
ATTCGAATTGAGCTCTTCCAGCAGAAATGCTGCGACGACGGCCGGCCGGAGGCGGCGGCGCGAAGTTCAAGCCGTTCGTGCTGCCCGTCAAGGCCAAGCC
CGCGCGTGCCCAGCCCCAGGAGGAAGACGAAGACGCGTACGAAGATGCAGACGCTGCCAGTAACCGCCAGGCGCTGCGCACGGGCGCGTCGCTGTCAGTC
AAGCGCCTGCCCTTCCTGTCCTTCTTGGTGATGGAGCCTGAGCGTCGTGCGCAGCACGTACGGCGGCCGTTCAAGTCCCCGTGCGGAGAGGGAGGCCGCA
CGCAAGAGAGCAACCGCCTGCTGCAGACCAAGACGCTGGGTATGCGCCGCCGCTGGGGCTCCGCCGTGTTGAAGCCCATGGTGCGCCACGACCTGCCGCC
AGTCGAAGTGGACGTGGAGGAGATCGAGACACCCGTGGAGCTCGAACCCCAAACAGTGGAAGAGCCTCCTGTGGTTGCAGCCCCAGTGGCCGACGCACCG
CCGCCGCTCGTGCTGTGGCAGAGCGAGTCTGACCCAGAGGTGAAGGTGGTGGTGCCCGAGATCGTCGGCAAGTTCCTGCGCCCACACCAACGTGAAGGCG
TGCAGTTCATGTTCGACTGTGTGTGCCAAGTCAGGGGCTTTGACGGGCAAGGGTGCATCCTGGCTGACGATATGGGTCTGGGCAAGACCTTGCAGAGCAT
CACGCTCATGTACACGCTGCTGATGACGGGCATGAACATGCAGCCGACTGTGAAGCGAGCCATCGTGGTGTGTCCGACGTCGCTGGTGAAGAATTGGGAC
GACGAGATCATCAAGTGGCTGCACGGGCGCGTGAAGACGGTGGCGCTGTATGAGGCCAAGCGTGAGACGGTGATTAAAGGCATAAACCAGTTCATCGAGG
GAAGCAAACGACCGAGACCGGGATTCTCGGCACAAGTGCTCATCATCTCGTACGAGACGTTCCGAATGCATGCGCAAAAATTCGCGGATACGCCAGAATG
TTGTGAGCTGCTGATTTGTGACGAAGCACATCGCCTTAAGAACGCCAACTCACAGATTAACAAGGCATTATCGTCGCTGGCGTGTCGAAAGCGAGTGCTT
TTATCTGGCACACCAATGCAGAACGATTTGGAAGAGTTTTTCGCAATGGTAGACTTTACCAACCCCAATATTCTGGGTACACCGAGCGAGTTTCGAAAGA
ATTACCTGGGACCAATCTTGGTTGGACGAGAACCGGATTCTACGGATAGGGAACGACAGGTGGCTCAGTCTTGTTCAGCAATGCTGTGTGAAATTGTGAA
CCAGTTCATTTTACGTCGTGGTAACATTCTGAACGCCAAGCACCTCCCGCCAAAACTGATGCAGGTGATTTGCTGCCCGCTGTCTCCACTGCAGGAGCAG
CTCTACATGCATTTTCTTTCGTCCAGTGCTTGTCGTGATATGATGAAACGCCAGAGCGCGAACGTTCTGTCTTCTATTACAGCACTAAAGAAGCTTTGCA
ATCACCCACTGCTGATTTTCGATGAAATGGGAAAGACCAATACCAAACTTCCAGGGTTCGGCAACTGCGCACAGTATTTCGCAGCTGCAAAGGAATCCCG
AGGCGGTGGAGGCGATACTGGTCTGCATCGACGAGGAGGTTTCGGTGGACGCACATGCTACCCAGAATGGTCTGGGAAAATGCTTTTGCTTGACCGCTTG
ATGTTTTCCATGAAGAAGACAACAACAGACCGGATCGTGATTGTCTCCAACTACACACAGACCTTAGATGTGGTATCTACCCTGTGTCACGAACGCCATT
TACCTTTTGTTCGTCTCGATGGAACCACCTCGGCAAAAAAGCGAAAGAAGCTCGTTGACACATTCAATGACCCGACAACAAATTCGTTTGCGTTTTTACT
GTCGAGCAAAGCTGGTGGGTGTGGCTTGAATCTAATTGGCGCCAACCGATTAGTACTGTTTGATCCGGATTGGAATCCTGCGACAGACAAACAAGCTGCC
GCTCGTGTGTGGCGTGAAGGGCAGAAAAAGATGTGTTACGTGTATCGATTTTTGGCAACTGGGACTCTCGAAGAAAAAATCTTCCAGCGCCAGCTTTCCA
AGGAGGGTCTTCAAAATATCGTCGACGATAAAGAGGAAGTTAACTCGCTGTCTTCTAAGGATTTGAAGCGTTTGTTTGTGTTCCGTAAAGACACTTTGTC
CGACACACACGATCAACTGAAGTGTGATCGATGCCAATGGAGAGGTGATAGTTCAGCCAGTGATCATATCGACCCCTCTCCCTCAGTAATTACAATTGAT
GACGATGAAAGTGGAAAAGAAACTGGAAATGAGACTTCTCCTGAACGGGACACAACAAGTGATGAAGACACTGAGAAGGACATTGACAAGGGATATCACC
CGCAAATTGGCATGCCACCAGAAGAAGATCTGAACAGCTGGGGGCACCACCGAGCTTACGCGTCCGTCGATGATGAAGTAATGCAAGCCGCACTACAACA
GGTTCAGAACGATCTGGTGAGTTTTGCGTTTAGCTGTCGTATCGACTGGGAATTACTTCAGGAGCACCAGGCTGAAAACGAAGAAAAAGAAAATCAGCGC
GACGAAGAGCGCAAGCGCAAGCGCATGGAGATTATTGCCGCAAACAAAAAGCGCTCTGAGCAGGAAAAAACTTCCAAACGTTCAAAGACGACAAAATCTA
AAGGCATCGATGAGTCAGATGAATCGGAGGTCGATTATTCCAGTAGTAGTGATGAAGAAGCGCAGGATGAAGTCCTTGGTGACAGTGAGTCGGGGAGTGA
GGATGAAGAAGAGTTTCTCTCCGCTGCCCGGCGAAGATCTTCAGCCTCTGAAGTTGATATTTCGTGCACTCCAAAACCACCGCTTCGACGTCATTCGCCT
AGAAGCAAATCGTTGGAAACGTCATCGCATCCTGCTCAAGTGAAAGCACCTCAAGCGTCACTTGCAGAGCCTACTTCTACTACGAGTAGTAAGAGAAGAG
TATCATTTGCTTTGGAAGTCGACACCGCGCCATCGATCGCGCACGCGGCAAAGAAGCAGCGGTATAGTGATTTTTCAGATTCTGATGAAGAGGACGCCTT
CGTCGATGATGTCCTCAGCGATCGCCGTCCAGCCCGTAAAGAAAAGGTCGTGGATACGGACGAAGAACGCAAGGAAAGCGAGGTTCCTTCAGCATGGAGC
TGCTCACGATGCACGTTGATCAATCCTAGATCAAACGCCAGCTGCTCTAGCTGCGGGCTCCGCTATCGGAAATCCCGTCCGCAAATCATCGATCTTGGCG
ACGATGAAGATGAGGACTGGTAGGAACAAGATAGAGTACATTCGTTGAGTAATTTATGATTAGCTGTGTGCAGTTAGTTGCCTTGCCGATTGCAAACTCA
AGAATCTTCACGGACGGAGACAGCACAATAAAGATGCTGTATCCTCAACTGACGGGAGCACTCTTCCTTGACCGAGGAAACGCTTTCGCGACGGTCGTTG
CCTCCTCCCGACGCAGCGATGCCCATAAATCGTCTGTCTTTTCCGAGATTATGGCTTTCAATGGTTGATCGTTTTGCGCTGCTTTTGAGCCGTTCCGTGT
TTTGCTTGGCTTGCGCCGTGGCTTCGTGGCAGGGTGATACTTCTTTTGGAGGCTCACTTCGTCGGCTTGAAGCGCACGCCAAGCATTTTCTGCGTCGTCG
GCAAGTTTTATAGTCGACGAGGAACCATCGGCAACCGCAGCAATAATTGTTTTGTTGCCGTCCTTTTCAATCATGCACTGCTGGAATGTTGGAGCCAAGT
TCTCGATCTCCTCCTCTTCCTGGATGCGTTGCTGCAACCTCTCCAACAAAGGGCCAACGGACGGGTTGCTGGGTTCCAGCCGCTTCATGGCAGTTGCATC
CTCCATTGCTGACTAAAACGACATCGACCAAGTAGTAGATTAGCCTTCGAACAGGGTGGCAGTGTGCCTCCCTTCCTCACCTGCCAGTGCTCCCTGCGCT
CTCGCACGAGCGCTCGGCGATAGAACGCCTTCACGCAACACGGGTCCCGCTCAATTACAGCACTGCAGTCCTGCTCCGCCTCAGCCATAGTGGACACGCT
GGTCTCGCTTTCGGGCATCTGGATCCACGCCCACGCACGATTGAGTCGCACCGCCGTATCCAGCCGCTCCGCAGCCTCGTCGGCAATTCCAGAGCTGCGC
AGCTCGTCGAGCACTGAGGTGTAGGCCTGCGCGGCCTCAGCGAAGCGTCGCTGCTGGAAGAGCGTGTTGCCCTCGTTCTTCTTGGCGTTCAGTGCCTCCA
TCATCGTCGTTGTCTTGCTGCGCCGCGCGTATCCAAAGTGCGGCCGCCAAGGCGCAAGTTGAAGCGCGCCGTTTCGCGTCCCAAAAAGGAAAGTTGTGCG
CATGTCGATTGGCAGATTCTGAGACTAATGCGCACTTTTGGCGAATCACCCAGTACTGACACCCTGACACGCTTGGTTACTCTCGCACACAATATGACCC
GATCCTTAGTCTAATGGCACAGACACACCGGGCTTCGAAGTATGCTACGAATTGTATATTACTATCCTAAATACGAATTGCTGGGCTCCAATTTCGTCGA
CGGTGGGACTCGAACCCGCGCCAACAACTGGGCTGCAAAGGCGACCGGCTTTACCCGGTCGAACCACTGGCAACGAATTTCATCATCGACGGCAGGTCCT
ACAGGAACATGATCGTGCACCTCGAACCAAAATGGAGCAAGTTGAAATGAACACCAAGCTAGCAGACCAAATACAGAGCGCTATTTACTAGTAGTATATT
GTGCGAGGGTGGTGCGCTTACGACGCTGAGTAAAGGACGACAGTTCTAGTTCCGAGGACACAACCTACGGGTCCACGATGCTCTTGCAGAACGCCTCCAC
GTTGGCGGCGCGGCTGGCCGTGTCGGGCGCGTCCTCGATGATCTTGACGATCTTAGAGCCGATCACAACGCCGTCCGCGAGAGCGCTGGCCTGCACGAAG
TGCTGGCGGGTAGACAGACCGAAGCCAAGTGCGAGCGGGTGCTTGACGTTCGCGCGGACTACAAGAAACACGTCACAATGTTAGCCTGCGCTTCGGAAGG
CAATCAAGCAACAGCAGACTGCGACTTACTCGTAGCCATGAACGCGTCGAGGTTAGGTGGCAGCTCGCTGCGAGCTCCCGTAACGCCCGTAAGGCTCACG
CAGTACACGAAGCCGTGCGCCACCGAGTCGATGAGCTTCATGCGCTCTTCCGTCGTGGTGGGCGACACCAGCGGGATGTAAGCAAGGCCGTGCTTAGCAG
CGTCGTCGCTGAGTGGCTTGGCCTCCTCAGGCGGCAGGTCCACAATGATGAATCCGTCCACTCCAGCTGCAGCAGATCAACAAGCATGCAAGAAAAAGAA
ACAGCAATCCGATCAGCCCACACCTCATTCATCCGCCAGAACTGACAGTGCTCTCACCTTTCTGGGCGTCAGGGCAGATCTTGTCCTCGCCGTACTGCAA
AATGTTGTTGTAGTAGCCCATGAGCACCACGGGCGTGGTTAGGCCCTTGGCACGTGCCTCGCTCACGGTGGCAAGGACGTCGGTCAACGTGATGCCCTGG
TCCACGCCCACCTGGTGGGCGCGCTGGATGGTCGGGCCATCGGCCTGCGGGTCCGAGTACGGGATACCGACCTCGATGATGTTGGCGCCGCCGCGCTGCA
GGCCCAGCAGGATGTCCACCGTGTCGGCCTTGGTCTTGAAGGCGCAGGGCACGAAGGTGATGAAGGCCGCCGTGTTGTTGGCCTTGCGCTCAGCGATAAC
CTCTGCGATCGTGGGTCTGCAGCGAAGCGATGCATTGCAAAAACAGGTTAATACTGCGTCGAAGAGGCTGCGAAGGAGAGAGCTCGCACCTGCTCATGTT
ACTGTCGTCTGCTGTCTGCGTGGAGAGTCTGAGTATGGCCGAGCGGTGCGCTGCAAGTGCTGACGTCGGTCCTGGCCGCTGAGCGGCGCCGATTGGCCAA
TTGTAATTTAAACCAATCATCGTGCGATATTATGCGCATAATCTTGATTTTGCCAAAGAGACCCCTCCCGACCAATCCGGGTCGAGCGTGGAGGGCGATG
TAACCATGTGCAAGTTGCACAGCGCAACGATAGCGGCTCAAGACAAAAGGCAACGAATTCATAATGGTGTCTGTGCGACTGCATTTTATTTAAGCCACGC
GCGGGCGCTTCTTGTGCAATCCGTTCTTCTTTGGCTGGATGTGGCTGCGGATGCCGCACGTGGAGCAGATGGGTCGGAACTCGCAAAACAGCGACAGGCA
CACGGGGCACACGTACGCCGTGGAGATCACCTCCCGGTGGCAGAAGCACATCGCACGGAAGTCCACTGAATCTTGCGATGGAAGCTTCAGCAGCTTGCGC
ATGGACGGGTCTGGCAGGTAGATCGAGATCAGATACTGCAGCAGCCCGCTGTGGTCGTTGGGCTTGTAGTAGATGCCGCCCGTAAGATACGCTGCTTGCT
GCATGAATGACGAGTGTTCGGTCGCAAGGATGCAGGCATCCACTGCAACACTCTTCTTCTGGGCCGAGAAAATGCCGTTCATGATGGCGATATAGTGCTC
CGACACGTCCGGGGACTTCTGCACGACCAAGATTCGCGGTCGCAGGTCTGGCTCCTCGTTGATGGCGCGGTT