Description :
From Genome Similarity Track
Location :
Scaffold_91:10541- 13124
Transcript NameFunction/comments
Phypl_g2869conserved hypothetical protein
Phypl_g2870kinesin-like protein

Sequence
2583 bases(100 bases per row)
GGTCACcaccaagagcaagaagaagaagacgcacctcaaggtcgtggccgtggaTTGCGAGATGTGCGTCACGCAGCAGGAGggcgccagcgagcgcaag
aCCAACGCGCTGTGCCGCGTGTCGGCCGTGGACGGCGAGAACATGCTGCGCAACATCATCTCGGACTTCCTCGTGCACCAACCCGAGCCCGGCTTCCACA
TGGTGGACCCCAAGACGGACATCCACGGCATCACGCCCGAGCAGATCGCCAGCTGCAAGATCACCATGGCGCaggtgcagaagaagatgctcaAGTACAT
CAGCAAGGACACGATCGTCGTGGGCCACTCGGTGTACGGCGATCTGGCCAGCATGCGCATCAACCACCGACGGGTCATCGACACGTCGCTCATCTTCCGA
CGCAAAGGCGGAAGTCCGTCCCGCGCGACGCCCGGACTGAAGGACCTCACCAAGTTCCTGCTTGGCTTCGACATGCCCCAGGGGCACGACAGTACAGTCG
ATGCCCAAGCGTCGATGATGGCCGCCAAGTATGCTGCTCGACACGAGACAGGGAAGATCATcccgtcggcgctggagctgcacggacCTCGTGTCAGGGA
ACCCCGTATCGAGGACGTCAGTCGCTATGAGGGGACAACGGAAAGAACGGAGTATACGGGTCCTGCCATGCTTGTTTCGACGGCGTACCAGCCTGTGCAG
ACGGCTACTGGCAAACCCGCACCGGTAAAAATCGCTGTGAATGAAGCGTCCTACATCGACATGGCCGCTATCAAGAAGGATGACTCCGGCGAGACCAAAG
ACAGGAAAAACATGTCCGAAGCGATGATCGCACGATCTTGCCGCTTGCGCGTGCATCGAATCCCGAAGGGCTTGTCCAGCAAAGACATCGAAAAGTGGTT
CCTCAAGAACACCAATATCGTTCCTACCGCAGTGGAGAAGATTGCGTGGCTGCCGAACCAAAACCGCGGCTCGTGCAGTGTGACCTTCTCTACCAATGCC
CATGCGGCGCTTGCCTTCGAGAGTGCTCAAAGCCCCAATGGGAAGACCAAGATCACGAATGACTCCATCGGTCGTCCACAGAAAACGATTGCTATCGTGA
GTTACATGGGGAAAACATACAAGAACGTGGCATTGGGCGTTCTGTAGATTTTGCTAGGAACCaagcaacgacgacaactcATGGCGTGGGTCTTCGTCCT
ATTGTCGAGGCCCGGGTCAAGCTTATTTACGCTGCTAATTCTCCTGCGTGATAAATAGAGGTGCATGTTTTCACGTTTCCGCTGTGCCTGGCTTGTTATT
TGGCGACTCGAGTGCTTCAGATGGCGATGCTGTTGTGGCCAGtatcatcttcttcttcgttgctgctgctcgcttgaAAAACTTGGCGTCCTTTTCAGCA
GCGTatcggcgctgctcgtcgatgaactgctgctcttgctgaaGTTTGAGGATCTCTCTCCTTTCTTTTTCGATCAGCCAGTTCTGCAGCTTTGTCTGCT
TCTCGATGGCCTTCCTTGACAGCTcaagctccttctcgacaGTCATGGCAGGTGCTGCTTGCATGTCGTTTTTCCAGCAATCTCCATTCCCATTTGTATC
GATGCTGGACGACCGACCTCGTACTCGATAAGTCAGTTCCATTGCGGCTGGCGGCTTAGCTGCTACTGATGTCGGAGACGTGAACGATCGAAGCTTCAGA
GCTGTAAAATCCAAAAACACAAGGTTAGATACTCGTCATAACCTGTGGTGCCTGCCCACTTTAAGTGGTACGTACGTGGTCGAGCCTTCATAATGTTGCC
ACCACTAAATGCTCTACCCCCAGTTGACAGCGGTGAACGAGATAACGACAGCGGCGGATTGCTAGGGATGCCTTGAAATCCTTGAAAGAGCCTCGTATGG
ATCGCTTtgagctcttcctcctcgatctcgaaGCGGAAAAAACGATCTGAGGCATCTTTCAACTGACGAACGGTATTCTCCAAGTGCTGCACAACGACTA
TGTTAGCAACGTAAACGACTTTCAAACAAACTTCACTAAACATTCTTACAGTACACTGTACCTGCTTTGCCTGTAGAATTTGTGGGTCAACAGCCGGACT
CGATGTCATTGGGCTGCCTTGAGGTGactgctgcagtcgaagctTTTCAATCTCCTTTTGTTGTTTCTCGTTCTGGTGTTTGAGCTCGGTGTTCTCATGA
ACCAATCGAACGACCCGTGCTTTCAACCCAGAAGAGGCCTGACCACCATTTTCTTCGTGGTTATCATTATTACTGCTACTGTCGCCATCATCCTCGCCAT
TACCGTCGCTTGACTTATTGGGTAGTTGAAGAAGCCGAACAACTTCACGCAACTGCTCCAGTTCTTCTTGAAGTTTCTCAACGTAAGCTGGGTCAATTTC
TCGCTGCTCATTCACACGCACCATAACCATGACCTTCTTCGCTCGGTCTGCGAACTTGAGCGTGGAGATGGATTCTTCAACACAGTCCAGCGATGGTGAC
AGTGTAGCAATGATTTTAGTTTTCGTATTGCCACCTAAACTGTCCTGGAGCAGTCTGGTTAACTTGGAGTCGCGATATGGCAC