Description :
From Genome Similarity Track
Location :
Scaffold_1230:1054- 2061
Transcript NameFunction/comments
Phyta_totarag12470hypothetical protein PHYSODRAFT_341850

Sequence
1007 bases(100 bases per row)
GAAACGAGCTCGGGCTTTCGTGCCCTGGTTGAACTCGTAGAGAAGCGCACCACAACTAACCCGCGACAGCGGGAGCCACTCGGGTTCTTCATACCCCTTC
CACTTGATGAGATACTCGCGAACACGTTTGGATGTGCGAGTACGTTTGGACCAGCGAAGGTCTAGGATCTTTTCCACTTTGTACTCGTCATTCTGGTGAT
CGATCTCCCAGCTGTCTTCCGGCAGTAGAATCGAaatcatcatcttcgtcgatgTTCACCTGGACTGTCGGTCGTTTGGGATGAAGAGCCCGCGGTTTCA
AGCGACTGACGTGTACCCAAGGGTTGACTCGGTAACCCGTGTCCTCAATCTTATGTTTCACTCTAAAGTCGCCATGAATCTCAACAATCCGGAATGGGCC
ATGCCAAAGGTGAGCTAACTTGCGACTCAAACCTGGCCGAACCTTCGGGATGTAGAGCCAAACCGCATCCCCGACATCAAATCCGGACTTCATCCTCTCA
GATAGCTCTTTCCATTTCCGGTTCTTCTCGTCTGAGCGAGCTCGTTTGGCTTCTCTCTGTAGGTCTTCGGTGCACGCTTGGGCGTAACTGTAGTCTCGCT
GAAGCTTTCTTCGCCATTCGTAAGCTGTCCGCTCAGGGACACTGGACGGCTTTGGTCCCAGCATAGCTGAAACCGTACCCTTAGCATCCCAGCAGTGAAC
CAGGTAGAACGGAGTGTCCAGTCGGGTCGCATCGAACGAGGTATTCAGAGCGAATATCAACCTCTCGGCATGTTTGTCTCAGTCTCTTTGATCTGCGTCT
GCGACGTACGTTCGGATGCTCCGGACGACAGTATGAACTGACCGTTCTTGTTGGCCATTCGCTTGAGGTCTGTAAGCTAGAGTAGCTCGCTGCCTGCTGC
CTAGTAGTTCTCGGAACCGGGTGAAGACTTCGCTCATGAACCGGGGATCCTGGACGTGGCGCAGCATTGATCTCGCTCCGAACCTTCGGAACACACATTC
TTCATAG