Description :
From Genome Similarity Track
Location :
scaffold_9:105383- 106928
Transcript NameFunction/comments
g4501.t1 Major Facilitator Superfamily (MFS)

Sequence
1545 bases(100 bases per row)
GCGTCACGCACAATGTGTGGACCGCCTACATCTTCACGTTCTTCTTCTGGTCCGCCCGAAGGTATCAATCGTCCCCAATGTAGCAATGTAGCCATGTAGC
CTTATCATTCCTCACCTTGTCCGTCATCGCAACTGTAGTATTCTGTTCCAGCAGGTCGTGGCTGGCTACGTGTTCGTGCTCACGGCCTCCAACAAACCCG
TGGGTATCGTCAAGGGCATCCAGGGCATCTCGCAGCTCGTCTTCTCGCTACCCGGCGGCTATTTCGCGGATCGTATCCGTCGCGACACGATCCTGAAGCT
CTCGGGAGCCATTGGCATCGTCGGCGCCGTCATCACCTTCGTCTCCGTGGAGTTGACGTCCATCAACGGCCTCTACGTGGCGTTCGGGCTCTGGGGCCTC
TTCGCAGCCTGCCAGAGCCCCGCCATGGAGGCGTTGTTCGCTGACTCCATCCCCCCTGGCAAGCGCAGCTTCCCGTTCATGATCAAGTACAACATCAGCA
ACTTGGCGCAGATGCTGGGGCCCGTGCTGAGCATCATGCTCTTCCTCTTCTACGGAGACCAGTGGCAGCTGCCGGAGCTCAAGCCTGTGCTCGAGTTCGG
CTGTGTCTTGGCTGTCGTGGGATCGCTCATCCTGTTCCAGTTCGATGACGACCGGGCCAAGGACTATCTGGTCGACAAGACTCAAGAGGAGAAGGAGGAG
GAAGTGCTGCTGGAGAAGATGATCGCACCGTCTCCGCTGCGCACGCCCAAGCTGGTAGGCAATGGTAATGAATTCGACATGGTGTACGACTACTCGGACG
AAGACGACATCACAGTGGACGACAAGTCTCCCCCGACGGCGACCGAGAACACGGCGCTGCTGCTGCTGAAGGGAAAGACCGCCAAGGAGATGGATCTGGA
ACGACAGCAGCGTCTACAGGAGGTGGAGGAGGAGGAGGAGGGATACATGGCGCACCTGGACGCCAAGTTCCTCTGCTTTCGCACCAAGCACGTGCCGTAC
ATCCTGTTTGTGTCCGACTTTATCCTCAGCAACGGGGCCGGCATGACGATCAATTTCTTCCCGTTGTTCTTCAAGGAGGAGTACGGACTCACGCCGATCC
ACGTCTGCGCGCTTTTCATGAGCCAGCCGCTTGTCGTCATGATCCTGTCGTTTATCGCGCAGCGGTTGTCCAAGCCGTGCGGACGCATGCCGATCATTGC
CTTCACCCGCGCATTCTCCGTTGCGTGTCTATTCTCCATGGCGTACGCACAGCCGATGGCTCTGCAGATTGCGCTGTTCCTGATGCGTGGCGGGATGATG
CGCTGCTCGCAGCCTCTCCGTCGGTCGATCCTGATGGACTACGTGCCCAAGAACCTTCGTGCGCGCTGGAATGCTTTGGAGGGTCTGTCGGTCTTTTCGT
GGTCCGGTAGTGCAGTTCTCGGCGGCTTCTTGATCGACGCGTATGGATACCGAATGTGCTTCATCATCACGTCGTTCGTCTATTGCGTGGGTCTATCCTT
CGAGATGGCTCTGTTGCCGCTCACAAAACACGCCGTTGAGAAATA