Description :
From Genome Similarity Track
Location :
contig_2:1053606- 1055618
Transcript NameFunction/comments
g672.t1hypothetical protein PHYSODRAFT_483835

Sequence
2012 bases(100 bases per row)
TCAGACCAAAAGAAACACAATAAAGATGCAAGAAGGTCACACCTCAATCCTGCTGGTTAAGAGAAGCTTTCGGTCCTGCTCCTCTTGAACTGCGACTTGC
AACTCGTGCGCTTCCTGCTGCAAATGACCTGTAAATGTGACGATAAACCAGAATTTAGCGTTGCACTGAAGATGAACACGGTAGACCACGTACAATTCTT
CTGCTGAAGAGACGCAGCTTCAGCGTTTGCACGAGCAACTTCTTCTTCAGCAAGCTTCTTCTCCTTCTCAAGCAATCGCAATCGCTGGTGCACTGTATCG
CGGTCGCTCGACCATTTTTTCTGTTGGTGCTCTAGCTCATCTTGTAGCTCCAGCTCCCGAGAACGCAAGGTCCGGATGAGTTCTAGCTGTTCTAGTCGCT
CCTCGTCCTTGGCACCTGCGTCTTCCATGCTAATGTCACGCAAGAACTGAGCTTCCTCTTGCAACTGGAGGTGCTTCTCCGCCAAGTTCTCTTTTTCGTG
CACCAGCTCCACGTTTTCCGCCTGCTGGCGGTCGAGTTGTTCTCTCAGCAGTGCGATCTTGTGCTTCTTCCTCACAATTTGATCCTCAAAGCTACCGCAC
GTCAAGTCAGACAAACACTCCAGTAGCGGACACTACGCCACGTACACTCTCAACTTGTCGAGATCAGCATACAACTCGGCCATTTCATCTGCTTGGGCAT
GGATAGTGACCGCTTTGGACGCCAACTCCGCTCGAAGCTGCTCGATCTCCTCGTACAACGCTGGATCTACGAAAATGGTGAAAGTTAGCAGCGCTACGGA
AACATTCTAACGAACTGCGTCTCACTATTGTCAACTTCAGCAGGAACTTCTTTCTCTTCGGTTGCGTCCTCATGCTCCTTCTCGTCGTCGCTCTGAGGCT
TCTCGTCTTTCGCTGCAGCATTGCGTTGATTATCCTGTCGCAGTTTCTCCACCGTCCGCTGGAAGTTCTGTCCAAGCGCCTGGAGTTCATTTTCAAGCTC
CTCACGCGGCTTGGGACGAAACCTCAGTGGCCCTCCGACAGTTTTCTTGAGCACGAAGTCGTTCACGAGAGCTCGCGAGTCTTGGAAACTCGGGGATCTT
CTCCTGGAGCGTCAATTTCAGAACGTCAATGAGCAGCTCTTGCTCCCGTTGTTGCTTGCGCAGGTCCTGGATCAACGCCGACCGACGATGCTCCTTTTCT
TGAGCTTTCAGTCCTTGAAGCTGCTCTTGTAGCTGGCTGATCGACCGCATCAAAGCGCGCACTTTTTGCTCGTGCACAGCCTTGAGCGCGCCAACTTTTG
CTGCAGACACGGAGGAATTCGTGTGAATTGGCATCCTTGGGTGTTAGAAGTAAGTAAAAGACCTGCCTTCTACTGCCGGGTTGGCTTCCGTAGCATCCTG
GGCAACCCCGTGCGAGACTACCAGACGTCGTAGCTCCTCCTCCCGTTTCTCCTGCCGAGCGATGGTAGCTTGAGCAGCCCGCAGAGCCTCCTAGTGCATG
AAGGATGGCAATTACTATCGTGAAAGCGGGTTGGTTGTATTCACGTACTTCTGTGGCCTTGAGTCGATCTGCCACACTGGATCAGCAATGAGGACAATCT
ACCATGAGTGGAAAGCTGACAAGGAGGCAGTGGTGAAGACTCATTCGATGCGTACGCATTGGATGGCGTTTTCTTGGCCTCAGCACGTACAGGGCGACGA
ACGCCGCTAGTGATACTGCTCATGAGCTTCTTGGTTGGTTTCGTGAAAGATGAAGGGTCAGTGACTGACAAGAATTAGGTTGACTTCTTAGCTGGTCTCG
TCTGGTAGACCCATGAGGTATCTCGTGATCTAGGTGTGCAGTAAATGGTGACTACAGACTACAGCCTTACACCAGCACGGGGTAGATCTGGGCCTTGTAG
ACCGGCTCGTGCTTGCACAGCACCTTGGTAGCCAGCGACTCGTAGTCGAACAGCCAGCAGTTGTGCGGCACATTGGGCACCTGGTGGATGTGCAGACGAC
CCGACGTGTCGA