Description :
From Genome Similarity Track
Location :
Scaffold_39:105331- 108720
Transcript NameFunction/comments
Aphas_H257_11456Hypothetical protein

Sequence
3389 bases(100 bases per row)
ATGAACGCTGGCTTTGAGAGCAACCACGTCCGCACGCACAAGTACACGACCGCGACGTTTGTGCCAAAATTCCTCCTCGAATCGTTTCGCAAAGCCGCCA
ACATGTATTTCCTCGCGGTGTGCGTTTTACAGTGTGTCAAGAGCATCTCCAACACGAACGGCTTGCCCACGACGCTGCCAACCCTTGTGTTCATTTTGCT
TGTCGACGCTGCGTTTGCCATCCAGGAAGACAAGAAGCGGCATGTGGCTGATCACGTCGCCAACCACCGCATGGTTCATCTTCTGAGGCACCCGTCATCT
TCTTCTTCGATATGTCAATCATCTACCGGAACGGACCATAGTCGCGCCACTAGCGACGTAGTCTTCACGGCGCGGCCATGGGCCGACCTCCGCGTCGGCG
ACTACGTCCAGTTGTTCAACCGGGAAGTGATTCCTGCCGATATTCTAATCCTGGCTGTGCATAGTCGTGACCAGCGGCCACAATGCAGCAGCAGTCACAA
CGACGACGGTGGTCACCGCCCTTTCAATGCCGATGTTCGTGGGGCCATCGAGACATTGTGCTACGTCGAAACCAAGTCGCTCGATGGAGAAAGCAATATG
AAAGTCCGAGAAGCACTCGACGTGACCGCAACCAGGTGTCGGGGGCCAGCAGACCTTCTAAAACTCCGGGGGCATGTGCTAGCCGAGCCTCCCAACAACC
ACACACACAGTTTTAGCGGCGTGCTGACATTGGACACAAGGTCGCCGACGACGGCAACGACATCAAAGGAGGGGACAGTATCGACCCCCATCACCCTAAC
CAACATGCTGCTGCGGGGGTGTACATTGCGCAACACCGAGTTCGTCTACGGCGTCGTGGTGAGCACTGGCGGGGACACCAAGATCATGCGAAGCAACAAA
CCCACGGCTTCGAAAGTGTCTCGACTGGATTCATGTGTGAACCAGTACATTGGTGTGTTGATCCTCATGCTCATCGCCTGCTGCTTGATGGCCGCGACGG
GAAACTTGCTCTGGCTTTACTTTCACGAATCGCGTACGCCATACTTAGCGTTGTTGGAGCCACCTTCGTCGTCCAACACGACAGCTCCATCGTCGTCGGC
CACAACCTCTGCCCTCACTACCTACGGCACGACGTTTTTCTATTACTTCCTGCTCATGTACCAGTTCATCCCCATATCGCTATATGTGTCCATTGCGTCG
GTCAAGTACATTCAAGCATGCTTTATGATGTGGGACGTCGACATGTATCACGCAGCGTCCAACACACCGGCGTTGGTGCGATGTATGGCTTTAAACGAAG
AACTTGGTCAAGTCACCCACGTCTTCTCTGACAAAACGGGCACCCTCACATGCAACACAATGGAGTTCCGCAAGTGCTCTATCGGTGGTGTCTCGTACGG
GCGAGGGAGTCCCCCAGCCCGCTACTTGTCGTGGCCACCCCCAAGCCCCCTCCCCAAGCCCCTACCTACGACCACGACCCCCCACGTCAACTTCCATGGC
CCTGAGCTGTATGCTCACATGGATGGCGCCGTGGGCGCCGATCAAGCAAAGAGAATTGACCTGTTTCTGACCGTTCTGGCTGTGTGTCACACTGTCCTGC
CCGAGACGCCCTCGTTGATGACTTCGATCCGTCCAAGTGACGTAGACTCTGACCAGGTCAGTAAGGCCGATTGTTCTGACCCAGCGCTGACCGCCGTAAC
CTACTCGGCCGCCAGCCCCGACGAGCAGGCACTAGTGTGTGCTGCAGCGTTCTTCAAGTACGCGTTCGTCAGTCGCACGCAAAAAACGACGTCAGTACGC
ATCCACGACTCCCTCGTGACATTTGACACGCTGGCCATCTTGGAATTCAATTCGACGCGGAAGCGCATGTCGGTCGTGGTGCGTTCAAATTCGCCGAGTC
GGACCATCTACTTGTTTACGAAGGGGGCCGATGGAGTTGTGATGCCGCGACTGGCGCCTCCCCGAGGGACTGCCGACCGGACACTTGTGGACCTTACGAA
CGGACATATTTCAGCGTACGCGAAGGAAGGGCTGCGAACGCTGGCGGTCGCGTACAAGGAGCTGTCAGCGTCGGCGTTTTCCAAGTGGAGCGTCACGTAC
GACGCGGCGGTGGCGTCGCTGGACGACATGGAACGGTTCAAGAGCGGGCAGCTGCCGAATGCCATCGACGAGTGTATGGACGAGTTGGAGGTGGAGTTGC
ACCTGCTTGGCGCCACCGCCATCGAAGACAAGCTACAGGACGGCGTCCCTGAGGCCGTGGGCACGTTGATTGACGCCGGAATGAAGCTGTGGATGCTCAC
GGGGGACAAGGACGAGACCGCCATCAACATTGGATACGCGTGCAACTTGCTCCAGCAATCCATGCGACTCATCACGCTCACGGCCAAGAAGTTTCCCACT
GCCGCTGCCACGTCCAAGGAAATCACCGACCAGCTGTATCAAATCAGCATATCCGGAAGCGCGCCCATAAGTGCTCCAAAGATGTCGCGGGCGCCGTCGC
TTCTCCGCAGCAGTCGCGCGCCAAGCCTTCGAAGTCGATCGCGCACAAAGTCGCATTTGACGCTGTCCCAGTCGCGCATTTCGCTGCGCAACACGTCGGC
CGACCCGACGGCGCTCGTCGTGGACGGCGACTGCGTCTACCACGTGATGCGACATTGCCCCACAACGTTCCTCAACCTCGCTCAAAAGTGTAAAGTCGTG
TTGGCGTGTCGCGTGTCCCCGGCTCAGAAGGCGGCCCTGGTAGCCCTCGTCAAGGAAAACGTGCCGTCCAGTCGGACGTTGTCCATTGGCGACGGTGCCA
ACGACGTGCCGATGATCCAGGAGGCCCACATTGGGGTCGGCATCTCAGGCCAAGAGGGCCTCCAAGCAGTCAACGCCAGTGACTACGCGTTGGCGCAGTT
CAAATTTCTGCGCCGGTTGCTCTTGGTCCACGGCCGTGCCAACTACGAACGTCTAGCTAAGTTGGTGCTATACATTGTGTACAAGAACGTCCTGTTGCTG
GTGGCGCAGTTTGCATTTTCCATGCAGACGGGGCTGTCGGGCCAGAAAATGTACTTGGAGTGGGGCGTGCAAGTGTACAACGTGTTGTTAACGGCGGCGC
CGATTGTCGCGCTCGCCGTGATGGACCACGACGTCCGCGACGAGATTGTGCTGCGACTGCCGGCGTTGTATCGAAGTGGCCCGCTTAATGTGCACATCAA
CCATCGCATGTTTGGGCTCTGGGTGCTTTCGGCCGTCGTTGAAGCTGTCACGATTGTCTTGGTGTCGGTCGCGGCGCTCGAAAATAGCTCCGGCGTGGGT
GGTGAGAGCCCCGGCTTGTGGTTTCTTGGGAACATCGTCATGACCCTGATCGTCGTGGCGGCAAATACTAAGCTTGTGTTTGTGCACCA