Description :
From Genome Similarity Track
Location :
Scaffold_3228:1053- 2611
Sequence
1558 bases(100 bases per row)
CAAGGGCTTAGCGAAGCCCGCGTACCCTGCGCTGTACTTGTGAAGGTAGTTAGCCAAGCAAACCACTTTCGAAGATCCTTCTGGGATCGGGGCGTCGGCC
ATGCTGCTATGGCCTTGACCTTGTCTGGGTAAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTAATCTCTGGTGACACGAAACGCACTTG
TCGATATTGGCGTAGAGCTTGTTCGCTCGCATTACGTCCAACACCCGACGGAGGTGTCCTAGGTGCACCTCCATGGCCGTCTTGCCTCCTTCGAATATGT
CGTCGAAGTACGTCTGTACGAAGATACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTACGGCATGAC
GAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTACCGCGATGAGCGGGATGTCGCTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGC
GCACTGTAGTCAAGCTTGTTTGAGTTTGTTATGCCTGTCGGTGAACTCGAAGCTCTGTAGCGAGGGTTCATCCGGCAAGGCCAAGAGACTTTGTGTATTG
GCCGATTATTATCGGGAGGTTTTACGTGACGGCTTATTGTTGCCTATTTGCACGACTGGGAGTGCTTGAATTGCCTCCCTTTTATTTCTTCCAGCCGAGT
ATTGAAGACTCGGTGATCTCGTAAAAGGCTTACCCGTGCCTGGTACCCTTCCGCTGTTGGGACCACGAGGATTCAAAGCACCTGCTAGCTTTGCTCGTGC
TAGTAGCGTGTTCTTATTTTACTGGTTGGCCTATATAAGTAGTTTACAAGGTCCAGTTTGTCCCGGTGCAAGGGCAGAACTGGGGTCTTCAGGTCCGCCC
GAACGATCGTCTACTATCCTAGTAGACGTATTGTTGTGGGAACGTCCTAACTACATTTGTAGCTAGAGTTCACGTGGGATTTCCAACACCACACTATATG
AATTGAGAGAGGTAGATTTTGCTGCGATGAACCACTCCAGCTGTCCGGATCAAAATCTAACAAGCTCTGGCCCCGGAGATGTCGGATCCACGAAGGGATC
CAAGTAGTACGACGCCAGAAGAGGATCTAAAACAGGAGCTGGATCCGCCCCGGGACCAAAGGAAAGAGGATCCAATCAGGATAGAGACGGCGGATCAGAA
CTCGGAAATGGTGGAACCTCGGTGGATCCGAGCTCAACACGCATTCGTAGAGCTGAGGAACAGGATCGCGACCACACCTATCCTCCGTCATTTCGATCCG
GAACGTCAACCTACGGTTATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCCTTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCA
GCCGGACGCTAAAGCCAAATGAGCTGAACTACGGAGCGGTGGAGAAGGAGATACTCGCGCTCTTGCGCGTGTTGGATCTCAATTACAATCTGCTGGTGGG
AAGATCCATCCAGATCCTGACTCGACACTCTACGCTGGCTTGGCTGTTCAAGTCGGCC