Description :
From Genome Similarity Track
Location :
Scaffold_21:105295- 107461
Sequence
2166 bases(100 bases per row)
CAGTGGTCGCCGGGCACCGGTGACGTGGAGGCTGACAATGATCAGTCTCGAGTCGCCCGGCGTAGTGGTGGCATTGGTGTGTGCTTGGAGCACGGGAGGG
CTCGAAGGTTGGGCTGTCACCGGAGGGCCCGGTCCTTCGTTAAAGCCAGTAGGGCACCCCGCACCTACTGGTCCTGGTCGTTTTTTGAATGAGCGACCGA
GGAGTGTTCCGCGTCGACGTGAGAGACGACGGGAGCTGGCGCGCGGCACTCCGCCGCGCGATGACCCTTCTTCCCACAGCGGAAGCAAATGAGGGACTGC
TTCGCCCAGCGCTGCCGCGGTAGGACCCGCGACGTCGATTGCTCGACGCGTTGATGGCGTCGATCTCCATGGGCTCGGGGGTAGACTCCCGGGCTTCCGC
AGGTATGGCTGCGGCGTACGATGCAGCGACCATGTAATCCTCGCGAATCGCGAGTGCAAATGACTCCTCGAGAGAGCAGGGCTCAGCTCTGGTGAGGCAG
CAGCGGGTCATAATTTCGCGCATGCCGAACACAAATACGTGGGCTCGCGAGGCCATGTCGATTGGCTTGGTGACGATGCATGACACCAGATGTCGCGTCT
TCTGGGCGTAATCACGCATGGACATCTGCCCTTGCCGAAGAGCGCAGAGCTCTGCGCGAACGCGAGACTCATCTTGCGGGGGCTCGAACGCGAGGCGCAA
GTCGCTCTGAAGCGTTTCCAGAGTCGGGAAAGCATCGGGGTCGATAACCAGCCCCCCAAGGGCCCATTCTTTGGCCTTCCCTGTTAACAAGGAGATGAGG
AAGTTCGTCTTGGCGGATGACGCCTCGATGCGTCGCGAGGCGATAGCAATGTCGATATCGCGGAACCACCAGTTTAGCAAGAGCCGGTTTTCACCGGCGC
CAGAATACGTAGACGTCTCCATCTTGACGACGTCATTCTGGGATGGACGCGAGGGAGTTGACACCCGCCGATTCGCATCGGCGAGCTCGCGTTCCATGAA
CTCTTGTGCTGCAAGACGTTGCTGGTCGGGCGTCGCTGAGCTCAGCAGCGATGCGACGACAGCGTCTCCGGACACCGCCACGAGGCGGTGAAGCGCTTCC
CACTCCACGCGAGTGAGATGGGGGAATGCAGCATGCTCCAGGGTCGCCCCGGAGATCTGGACTTGGCTCATCGTAGACTTGGTCGCTGGAAGGACTACAA
AGTGCTACCAGGTGTAACGGGGTAAGAGATACCGTTACTAGCTTACACTATAGTGCGGAGGAAGCTCGCAATAATAAAACCAAGTCTTAGGTTTGTGTCA
AATTCAACTCTGATTTATTTAGGACCAGGGCGGCTACCCCTGGCCTCGTGTGAACCACTCAAACACATGTCTATATCTGATTGGTCAATAAGTGAGTCTG
GCTCCTCACTATCAACCAATCAGATGATGACACTTTGGCTCACGCTACCCGTGTGCCACTTTACCTACTTATGTAATAACTAAAGAAATATCTATCTACT
TATGTAATTGGAGTTGGGCCCATTACCTAGGATGGTCCGACGTAGCGACCACAACACCATACGAATTCGTGTATGATACATGTTGCTCAGTCCTCTGCGT
CAGCTCGGAGCGTAACCACGATATCTTGCAATGACTTAGCGCTCCACAGCCGTCGTTTTACCAGCACGGTTTCATCTGAGTCGATCCTCTTGAGATGACC
CATTGCCATAGGCTCCTCAAATGCCAGTGCCTGCCCGCATTCCGTCAGCCTCGTCTTCACCATAGGCTCCTCAAACTTCGGTGTCTCCTCGCATTCCGTC
AGCGTCGTCTCATCCACACTCCTAGTGATAGCCACCATCGACTCGACTGGAACGTCTCCATGTACCCCCTTGGCACGTTCCAGCCCCATCGTACAGCTAA
TGTGAGATCCGGACTGCCTCTCGGCATATTTCACAGGAGCACGCAATGCTTTATGCAAGTGAAGCCACTTCCCCGGATCCGCAGACACCTTCGCTGCCAA
CTCTTCAAGTATCGTGCTCAAATTGCTGCAAATGAATCTATATAGATCTTCCTTGGATATTTTTAGTAGTGCTTCCGCACCAGTCACATGTTCACGCTTC
AAACCGCAGTCGTTCTTGTAATCTGAGTTGCTCGTTTTTATCCACCATCTTCTTTAACTCAGCTAA