Description :
From Genome Similarity Track
Location :
Scaffold_514:10528- 12032
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_514-abinit-gene-0.13Ankyrin 2,3/unc44

Sequence
1504 bases(100 bases per row)
TTGTGGCGGCGACGAGCGCCTCGATCACTTGAATCGCCTGGGCGGAAGTCGTGAAGAAGCCCAGGCATGCACAGTGGATCGGCAGTAGTCCAAAGATATC
GCGCACGTTTGGATTGGCGCCTTTCTCGAGAAGGAACAGTGCAGCATCGACGTGACCGTGGAGGAGCGCCAGGTGGAGGGGCGTTTGGCCCATGTGATTG
CAGGCGTCCACGTCAGCATGGCGATGCTCGATGAGGTCCGTGACGAGCTGGAGCAGCACTGATGGCTCCATGATATAGCGCGACGATCGGTACCGAAAGC
AGACATCCACGCCCCGCATGCGTTTGCGGACCACGCATTGCGAGAGCAACGCATGGAGTACGAAGTCACCATGAGAGTTCGAGACGTTCACGTCGAGTCC
CTTACGGAGCAGCGTCTCCAAGAGCTCCACGTCGGGCGAGCCTTCCTCGGAATCCAACTTGATCAGCGTGTCAAGCGGCACGACAAAAGTTGTGTTGACC
TGCGAATTGTAGACGCTGGAAATCAAGTGGGAGATATCGCTCCGGACTGGTGCGGCCAGTGCANNNNNNNNNNGTGACCTGCGAACTGTAGACGCTGGAA
ATCAAGTGTGAGATATCGCCCCGGACTGGTGCGGCCAGTGCACAACCCCACACAGCGACATCCATGCCGTCCTGCGTGATCGCATCGACGCTTGCGCCGG
CCTCCAGCAAAGCCAACACCAGTGGATTATTCTTGGTGAGCAGCGCGAGCATTAGTGGCGTCGTTCCGTCCAGTGAGCTGGCCGCGTCAGGTGCGGCCCG
AGCAGCAAGCAGCGCACGCGCGATTTCGTCCTGACCGAGTTCAGTCGCCAGGAGCAGTGCCGGCACGCGGTTGTAGTCGAAACGGGGCACATCAAAGGCC
GTGTCCAGCAGTTGGCTAGCCCACGTCGCGTGGAACTCGAGTTTCTGAGTCTGGAGGCTCGCGACGTCGATCGTCGGCCCTGCTTCGACTTTCGTCGTCT
TGCTGTTGGCAGCCGCAGCGACAGCAGCAGCAGCTGTGAGCTGCTCGTGCAAATCGAGGAGCTCTTGGCGCTTTGCAAGCGCTTCGTTTTGCTTGAGCAT
GCCACGCTTGATCAAACAAAGTGCGAGTTCTACGATAGCGTGAGCGGCTTCTTGTCGTTTCACATTATCTCTTGGACACTGCGGCACTCGCTCGCTGTCA
AGAATCGCGAGGAGATAAACCAAGACGCCGTGGCTCAGTGCGACATTGATGAACCGATCCGTGTCCGTGATGGGGACGTCCACAGTCGAGATAATCCCAC
TCGTCATAGGCGGTGGCGCCGTCTTCGAGATCTCGGAGTGACTACTTAATATCGCCGCCAACACGGTGACTGCAGCCTCGAGCTGGAAAAAGCACGTCTC
GGGCGTCTCCAAGACGCGGACAATTGGCGCGAGAAGCCAGCCGTGCTCCGAGTGGCTCGCCTCTTCTCGAGTCCATGGCCACACCGAGGGATTTGCCGGT
GGAG