Description :
From Genome Similarity Track
Location :
Scaffold_227:10528- 11761
Transcript NameFunction/comments
Phyke_g6899hypothetical protein

Sequence
1233 bases(100 bases per row)
CGGCGAGGACTCGTGAATATGGGGAATACGTGCTTCATGAGCTCAGTGCTGCAAGCCCTGGCACACAACCccatgctgcagcactacTTTTTCGTGGCGA
AGAGCCACGATACGACAAtctgccagcagcaacgacggaGGTTATTACTGAAACAGATGCAGCTATGCGAGAAACAGGACGAGGAAaaagaggacgaaga
aggaggacaGTCGTCCACTAGACGTGATACCCGGCCTGCTATCACCGTCTGCTTGGGGTGTGAGCTGGCTGCATTCATGGCACAACTTGTGCctctccag
caacaaaagtCGATGATGGCACCACCTATTGTGCCACAAGGTATTCTTGAGGCAATGTGGAACGCTTTCCCATCGTTCATTGGCACTGCACAGCACGATG
CACACGAACTGCTCATAGCGTTGCTGGGTGGGCTTcactcacacacacacccaCGCGTGTTTGTTCACGGAGGTGTTTCTCCACGTTTTACACCACGTGG
TCACAGTTTGTGTGATTGCGCGGTGCACCAGCACTTTTCTGGTGTTCTACGCTCTGAACTTGCGTGTGAAGACTGCGGGACGGCTTCGCACAAGTTCGAT
CCGTTCTTGGACGTGTCATTATCACTGGGTGAGGAGAAACGCCAAGATGCAAAAGATCAGAAAAATGGAGGGAAGAAGAATGATACAACGTCGGGATCGT
CTGAACTGACATTAGAAGCACTACTTCGGATATTTACGGCCGAGGAAGAGTTACGAGGTATGAATCAAGTGTACTGCTTGCGCTGTTCCAAATACCAGAC
CAACTACAAGCGCCTTACTCTTCACACGATACCTaacgtgctggtgtttcACATTCGCCGTCTTGACTTCTACCGCcagcagaaactgaagcagaCCGTG
CGCTTCCCGCTGATCGGACTCAATATGAAACCATTTACGTCGGCGGACAATGCAGACACCACTACTCGAAAGAAGGACAGTGCTGGATAtgaagagagcg
acgacGTATACGACCTCGTTGCCGTCGTGAACCACCACGGCGACTCCGTAAATGGTGGTCACTACACGGCGTTTGTGCGAGATGAACTGTCCAAGGTATC
GACTACCTCAAGTCAGCACGCAAATGGTACAGGTCAGCACCAGTGGATACTCTTCGATGATGTTGAGGTGAAGACTGTATCTGCCGCTGAAGTCGAGCAC
TCCCAAGCGTACGTGactattttttttgtggtg