Description :
From Genome Similarity Track
Location :
contig_2:1052667- 1054302
Transcript NameFunction/comments
g817.t1ETL43144.1 hypothetical protein L916_06280 [Phytophthora parasitica

Sequence
1635 bases(100 bases per row)
CATCTCGGGCAGATTCCCATGCATAAACTGCAATTGACTTGCACACGGTCCAGCCCGGAAATGACCGCTTCGCCGCCTGCGTTCGCGAGATTTGCTGCCC
GTCGCCGCCACCAACTCAATGCGCTCGCATCGATGGGAGAAGTTGCGTTAGCCACATCCTGTGCATCGAAGTCCACGTGTCCATTGCCAATGGAGACTTT
CACCTTCTGAACTGACCGGGATGGACTGTAGCTACAAACGAGTTCAAGTGATCGGGTAGAGATACGCTCGAAAGTGTGTGGTCTTTTCTCTATTGTGGTC
TCAGACTGAGACTTTCACTTGGCAATTTCAACTCCCGTCGACACGTTTTGTAGACCATGGGGGCCGTGGTGCTCATCTCGCCCGACACTTGCAACAAGGT
GCAAACCTCCGCGTTCAGCGACAGTTCAAATGAACTCGACAGTCCGCACTACGACAAAGGCCCGTTCGACTACGATGACGAGGATGAAGAGGACTTGGCG
TACCAGGGCCACTGTCTGCTGCACAATGCGCTCTGGGGACTCTTCTACTCGGTCGCAATGCTGGCCGCGCTCTATTTGTTCATGGTCGCAGTCAAGTTCA
TCGAGTCCGGCTTCACCGTGGCCTTAGGCTGCGACGCCAAGGGCGCGTTCACAATCGCCGACAACCCGTTGGCGGGTCTCGTGCTCGGACTCGTGTCCAC
TGCGCTGCTCCACAGCTCCAGCACCATCACGTCCATCACGGTGGCGCTGGTCGCAACCCAGGGCCTCACCATTCGCCAGGGCGTGTTCATCGTCATGGGG
GCCAACGTCGGCACTTGCGTCACGTGCATTGTGGTCGCGTTCGGCCAGATCAAGGTCCGGTCTCGGTTCCAGCGCGCCATGGAGACCGCCACCGTGCACA
CCATGTACAACGTGTGGTCGGTGCTCATCATGTTCCCCTTGGAGGTCCTCGCGCATCCGTTAGAGCGCTGTCGGTGCTCATGTCCAATGCCAAGACGTCG
ACCGGGAGCTTTACGAGTCCCGTGGATGCACTGGTCAAGCCGTTTGCCAACCTCCTCATCCAAGTGGACACGCAAGCCATCCTGGATATCACGTCCGGTG
CCAGGGAGTGCACCGATGACGTGTCGTTGCTCTCCGGGGGTGCGTTCGAAGGCACCTCACTGACCGACGGCCAGATCGGAGCTATCGTGGTGGTCATCGG
CTTCCTGATACTCGCGTTTTCGCTCATCTGGTTCATCCAAATGCTGGCCAAAGTGTTTCTGGGACCGACCAAGGTGCTCGTGTCGAGGATGCTCGCGTTC
AACGGCTACGTGAACATCGTCGCGGGTGCGGTCATCACGTTCGCTGTGCAGTCGTCCACAGTCGTGACGTGTACACTGACGCCCATGGCAGGCCTCGGAG
TATTCACGCTCGAACAAGTGTATCCGCTGATCGTTGGCGCCAACCTGGGCACGTGTGGGACGGCGCTGCTTGCTTCACTGGTCGTAGGCGACAGGCAGGC
CGTGGCGGTTGCTCTCGCGCATCTGTGGTTCAACGTCTTTGGCATTGTGTTGTTCTACCCGATTCACTTCATGCGTCGGCCGATCCTGGGCTGGGCTCGC
TCCGTTGCCTACTTCAGTGCGTCGTGGGCGGTAGT