Description :
From Genome Similarity Track
Location :
Scaffold_463:10526- 12107
Transcript NameFunction/comments

Sequence
1581 bases(100 bases per row)
AGACTCAAAGTTTACCTCTAAGTTCTGGACAAAATTGCTGGACCTGCAAGACACCAAGTTAAAACCAAGCAGCGCCTTCAAACCCTCAACGGACGGCCAG
ACAGAAATCACAAACCGTTTTCTTGGCGATTTCTTGCGTGCCTACGTGAACCCACACCAGACCGATTGGAACGAATTCCTTGCGTTGGCTGAATTTGCGT
ACAATTCTCGCGTCCACGCCAGCATCGGAATGGCTCCATTCGTCGCCGATTTAGGGTATTTACCACGTTCCGTGAGTGACTTAGTGGTTCCACCTCGCGA
CGGCCCTCGATCCGCCTCTCGATTCGTGGACACGCAGCAAACTATCCTGACCGAATGCCAAGACGCGCTAGAACAAGCTCAACAGCGGATGAAGTTTTAC
TATGATCGCAACCGACCAACCACTTCGTTTCGCATCGGCGATCAGGTACTGCTCGACACCTCAAACTTGGCTCTCCACCACGTCGGCAATGATGGAAAGC
GGTCACTGGCCCCGAAGTATATCGGACCATACCATGTTCTCAAGATAACGACTCCCGATACATACAAGATTGGCCTTCCACCAGGTCTCAAACTCCACGA
CGAGTTTCATTTATCTCGACTAAGACGCTACACGCCGGACGACTCTGCTACTCAAGACAACCGCGTTCCAGCCTTGATTACACACGATGGAAGCCTCGGG
TTGCAGGTCAAGGAAATTCTCAAGCATCGAGTTCGTTGTGGTGCCGACGAATATTTTATTCGTTGGTACGGCAGTGCAAACCAGGACTCATGGGAACCTG
CCGAATCGCTCATCCAAGTCCGCGGGCTTATCGACGCATTCCATACTCGCGCCAAACATCACGGCCTCGGACACGCTCTCAAGCGGCTCAAGCAACCACT
ACGCCGCTTTCCTAAGGGAGGGAGTGTGACAGCGCGCCATGGAGTCCACGACTTCTTCGGCTGCTGTCTGATTCATCTTCGAGACACACAAGATGTTCTC
ATGCAGCTATCACCCACAATCCGCCACTCCACAGGCTACGTGAGCTGTAGGTAGCTTCCGTTAACGTTTGCACGCTCAATTCATTCTTAAACTTGCCACT
TGAGGATCACCCGAGCTCGAACTCGGCAGAGTTCGTGACACGTAAACTCTGCCGAGTCGCCCAGAGCAGCTCGAATCCCGCGCGTCTGGTCCAGCATCAC
CTGCCTGTTCGTGCGGAACCCATGCAAACACAGCACGCGGATCTTCTTAGACGAGTCGAATGGACGCGGGTTACGCGCCGTAGGGTGAGGCAGCTTCTCG
GCGACGATCACCATGGGAAGTGCTGGAAATGCTGGAAAATGTCGAGTGAGCAGATCCAACTTCAAGCAGGCTGGCGTACACAAATTGGCCATGGATTTGA
CGTCACGAGCGACTCAACTCTGGTGTTTGAGGCTCAAATTGAGCAACTTCGGATTGTTAAACACGTCAAGCAGTGACTATATTCTGGTGGTTGCTGTCTA
TACACACTAACAGTACGCCTCAGAGTCGTGCCACCGAGCTCTGGCGTGTATCCTCAAAGAACTGCCAGATTGTGCTGGCCA