Description :
From Genome Similarity Track
Location :
Scaffold_133:10525- 15586
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_133-snap-gene-0.24Phosphatidylinositol kinase (PIK-L4)
Pytap_DAOMBR444maker-pag1_scaffold_133-snap-gene-0.25Phosphatidylinositol kinase (PIK-L4)

Sequence
5061 bases(100 bases per row)
tGGCGTTCGGTGTTCAGtAGTTCAGAAACGAGATCCcACCGAGATAAGCGCCACGCACACTCAAGAGCGTGGGGgTAGAGAGTTCCCACATGCTGAGGCT
CTTGAGTTACAATGCCGTTTATATGTTGGAGGGCACTCTCTAGCCGACCGAGTTGAATCAAACACCGTACTATACCTGAATATAAAGCTGGCTTGATAGA
TCGTGGGTCTTTTGcatcccccAAATCAACCAGTTTCTCTTCATGAGACTCCCCATCGCCATCCGGTAGACTACCGTAAAATCCGAACGAGGCGTGTGCA
GAATGCACCTCTTGTATCGCTTGCTCATAGCATGCCAATGCGTCTTCCCACTGAGCAAGCTGCTCGTGATCAACAACCTGATGAAGAAGATCAACTAAAC
TGGAcTCCTCCTCTTCAAGGGCAGGCCCACTTGGGCTTTGAGCCATATGCAACCGACGAAGAGTGGCGAGACCCGTCAAGGCGTCAGGCTCTTCAACTTT
GCTATATAGCTGCTGAAGATAAGTTGCGTGTTTTGAGATGAGTTTCAAGTCAACTGGAAGCATAGTAAGCAGGCCACTTGTTTGTGCAGATTCTGTAGTC
TGAGGcGGTTGCTGCTGTCGTAAGTATACCTCAAAATATTGCAGAGCTCGAGCGAATGCTTTTATACGAAAGGCTGCACTTGATAGAGCTTGACTAGGTA
TATCTTTCAAAAACTCCTCCAAATTTTCCTTCTCTTGGTCATCCAGTTCCGATGGTATTTCACCAGATTTGTTTtGGgTTTGCGCTGTTGAGCCTCTCCC
CGCACTCAAGGCTAACCTTTtCTTTtCACTGTtCCAaaCCCACTCGTTCAGCTCATCGATTGTAGCCATAATTGTTtGTGCACACTGATGATGTCGACTA
GCGTATTCACCAAAAGCCTTTTCCTGGCCATCTTCGGAACGTGACGAAGTACGAGAACCAGTTAACCCTGCCCGATCATCCATGACTCCGTTGTCACTCA
AAaCTGCCATGATTTCtCGTTTGACCTCTTCGTAGACTTCCGGTCTTCCTGAGCATAATACGTTTTGGAGCAGGTATGGAAGTAAGAAgcGTCCAATTTG
TGCACTTGTGCTCACAACCATTTGGCATGCCTGGAAAATCTTCCGCTCAGGTGGTTTTGAGAGTTCAATCAACCGGCGGCACCACCCGTAAAGCCATTCT
TCATAGgTCGACGAGTATTTCTCATAGAATGTCAaTTCAGAACCCATTCTAACCTTCTTCTTGTTGTCAATTGAATAGTTGGTATACCAGTACGGTTCCA
CATATTCAAGCACGTCCTTCCGTTCAAAACGTCTCTTCATCCACTCCGGCATCGGTGGCCCGGTTTTGCGTTTCGCGCGACGATCCGGGTTGTTTAGGCC
GCTGTTGATGGATTGTCCACTGTGCTGAGGATCTTCCGTTAGCTCAGCCAGAAATTTCAATAACTCCTGGATTGAGAAGGCGACTTCGTCGGTGTTCTCT
GGAGCAGCGCGGAGCTCCTTGACGAGCCAGTTTTCGATCAAAACACAAGCAAGATCCTTCGTTGAGTATTCGAGACGAGTCTCAGGTCTATCCCGAAGTA
GATTTGAACTTGTCGTTGTTGAGCGCAAAATGTTCGATGGAATCCGTGCTCCGTCAATAGCGCCCAATGCACCCAGACATTTTGCACACTGAGATCGAAC
CGATTCAGTGgTATCTGTTCGTGCAACACTGAGGAGGgCAAaCAATATGTCTAGAACAGTGGgATGAATGTAATCATCCTCAGAaTGCAGAAGtAAGCGT
AaCTcGTCAGCTCGTGACACAAGAGTTTGATGAATATCACTCAATACGATCTCCCGAACCGCAAGATCCCAGTGAGAAACGTATGGAAGACAATTGATCA
GATAATCAGCCAGGgATGCTCTTGCAGGATcTCCAATCTCAGCGATAtATGATGCATGGATTTCGTCGAGCGCAGGTATGTtCGGAaTCAGCCGTacccG
GGGAAATGCGTGCTTCAAATCGTGTAGACGATCAACGAAGAGATATTTGAGAATTGCAaTGGCCGTCAGCATTCCTGAGCTGTAGGCTGTGCATTCGACG
TGGTCGTTACTTCCATCTTTCAGTTGTTCCGCGTAtCcGTGCTTCATAGCGATATCctCGCTGGGATTGTCAATGCATGGTAATACACTGACAACTAGaG
ACACAAAGTTCGACTCCAATGCTTTAGTTGTCAACATTCTGATGAAGATCCCCcATGCATGTACAGCATCATCTTGAAGTGCTTtGTCATGGAGGCCtAC
TTTCAGAATAGCCATGACTTTtGGTaCAAAGGGgTCGAATGCACCTTTCAAGTCATCTACACCCCcATCGTCTTTGCGATGAAAGACGCGGAACAAGCAA
CCAATGCTTCGAATAGCTCTGATACGATTTTCTCGCCGTGGTTCATCCTTGATTTTGTTACCGAGATCGGTCATTAGAGCAAGAAAATAATGACGTGGCA
TTGTGAGCGATGAGCCTTTGTCGCGTTGTACCTGATCAGTGTCTTGGTTTagATAGCTGGAAATCTCTCGAAATGCCCGCTTCGCGAGACTAGACTTTTC
CCCGCCCAATTCCCAAACCAGCAACTTGAGGAGACGCAGGGAAGCATGATCGATAGCATCTCGTAGAGTGGTATTCTGTTCGAGCCgATTGAGCAAAAAG
TGCCATTCCTCCGTTCGTTTGGTGTTGTCTTCCACCTGTACTTGATGGAGTACAAGTTCCTTCAATACGTATGCAATGTTTTCGTTCAGTAATTGTTTCA
aaGTCTTCGTCGGAAGACGGGAAGGTTCTGATGACTCCTCAaTCATTACCACGTCGTCGCcGACAAtAACTCCATTATATGCTTCCAAGAACGTTTCCAG
CATATCACTCTGTTGGTCGATAAtATAACGTGGAACAACCCATGGTGCACTGTCTTCTAGTAAGATCGCTTCGTCAAAACTTGGGCCGAAAAAGACAGCA
ACGAAGCGTTtAAGACTGTCAGTCCGCAGCAGAGCATCGACAACAAAAAAaTACAACTCGGATGGGTAATCCGCTAAAAGTCGCGGCCAGGAAaTTTTGt
GGCTctCAAAAATTCGACCTATTTGATCGAACGCAGCAGTTGCCACAGGTCTCAATGCGGACTGGGTCTTTATCCACAACGTGAGAAGCTTAAGAATGCC
CCAAACAaCGAACTCGCGCTCTCCGCAATGTTCTAAATTCACTGCACAGCAaCAAACtCCCAGAGCTTCGAGCGTTGATTCCAGTAGAAGAAACTCACGT
GATTTGATTGCTGCGTCAATGGCACCACCCAGTAGCTCGGTCACCATGTGTGCAGATCCCGGTTGGCCGAACAACGTTCTGACATTCGCCACGTTCACGC
AATTTCGTAGGGCCCGGACAGCGACGCGTCGAACGCACTTGTCTTCATTGACTGTCGAATGCATGATCACTTTCAAAAAGTTGTCTTGTGTCCACTCGAG
GGAATGATATCCGTGAAGAATAAGcGAACTCAAAAGGGCAGACTTATGAATATTAGCATCAACTTCCAAGTTTTGCTGACTGTTCCCTGCAAAGGCTGCC
ATGCGTTCACATAGCTCTTTCCGTGCTGGCGTGAGaTCTtCATGTTCTTCACGTGCTGCGAGTGGACAGCACCCAGTTGGATTCTCAAGCCAAGCACGAA
ACTGATCGTGATCCCAACtctttATTGTGCTGCAACAGACTGCTCGTTGAAGTGCTTCCGCACAAGCATTACGCAGATaTCGGTCACCGTCAGTATTAGG
CACTCCAAGTATGAGATCAACAAGATGTTTcATAGCCTGCTCACGACCTCCCACGGACTGGTCTTCGTCAACAAACACAACGAGCGTAGGAAGTAGAGAG
ATGTAAGCTGCTTGTGTTTGGCTTTGAGCTGGGGTGTGGGATAAACGCTTGACAAGCAGAGTagTCTTGTTTTGGGAAACGTTAGTGCTAGCATGATAAT
AGCGAATCGATGACATGATGGCGACAAGAAAAGCCCGCATGTTTGGGTTCAACTTCAGTAGCGAATCCGACAACCGATTACATCGTCTCAGCCAGTTCTT
CANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNgCAAGaTAAAACCTCCCGCATCACCGCTTGTGTTtCAACTCGAGCAATtGTCTCCAAGAGGGGACGGAGTGGCA
ACAAAATTCGTAGTGCAGTTAAGATGCTGCGAGCAGCAGTTTGACGGGTCTGGTTGATTGCAGACAAAAGATCAACTAGATGATAACATAACTCGTCGCA
TaCgCGGTCATCATCATGCACACGAGGTACATTAGATGTAATTGACTCAATTGGTCGCTTTCGCTTTCGGCTCCtGCTCGACATTGTTTCATTCTGTTGA
TTCTGTTGGTAGATGACATTTTTGGCAAgcTTTCGAGCGAACCTTGAAAGCCTGTTTTGAGAACCGAGATAGGTGTGCACCATGTTGACAAAGCTTGTTC
TAGCGTCCTCACTCAAGTCATGTGAGGCCTGGCTCCGGATAATCTGAAGTGCGATCCAAATCGGAGCACCATGAAcATCGGTCATGAGTTGCTCACAAAT
ACTAAGTAGATGGCAAGAaATTTGCGAGCTCGGGCCTGAaTCACCACCAACagATCGATGTTCTGTACTCAGTCTTGACGTTACCCATGACTCAATAATC
TCCCACAGTTCTTCCTTACACAATTGAGATACTCCAGGTAATTCTTCCGAGATCTGACCAA