Description :
From Genome Similarity Track
Location :
Scaffold_70:105217- 106259
Transcript NameFunction/comments
Phypa_INRA-310PPTG_17489hypothetical protein

Sequence
1042 bases(100 bases per row)
GTAACTACAGAGCTATGTGTTGATAAATGCGCTAGAGAGTTTATAACGAATTGAGTGTAATAACTGTATACTAGAGTGAGGCATCACTTTCATTTAAAAC
GCTGGTCTTTCCGCACAACTACCGGGTTCTTCGTGTAATAGTGGTTACGGTTGGTTACCTAGGGCATCTTGCTGACTGGGGCTGGCCATAACAATTACTT
ACGATCGCCTCTTCCAATTGATGAAACGTATCTACCCCACGCTCTTCCAGTTTAATCTCAGCTCCTGGCCCAATGCTTTTGATCGATTGACCAGGCTGCT
GTCTGTCGCCTCCGGGACGATCTCCTGTCGCTTACAGCTACTCACGTTCGATTTCGGGACAACAAACACCAGTGCTGCTCGCTTCGAATTGCTGTGCATC
GCCTCCAACAAACTAAATTTGTTTAAGACCGAGTGATTTCAGACGTTTTGACAGGATGCACCATTGAGAATGTCACCTTGAACATGATCACACGATTCTG
TGCATCGGTATTCCAAGCGATGACATCTTCTGCTGCAGCCATCGAACTACTATCGATCAGGTTCATCTTCGGGAGATAGGATAGAACCAGTCAATCGACT
CAAGTGCTTCAACTCCATTTATGATACGACCCACGCGCCGCTGCAACTGGCGGCAAATTCTTGATCTTGAAAAGATCGACGTGAAGACTCGCTGAAAATC
GCTTGGCCAGTTGCGCATCACTCCTGCTAGCCGTAGTATCAGCAGTCCGCAACAATCGCAATTCAAACTTAACTGCTCATGCACTTTGGCCTAGAAAACA
GGGGTCCCGAAATGCAGTTATCAGATTAATACTTTTTATACAATTCTATTTTCTATATAATATATAATAGCAGCCGATAAAGCAATAATACCTAGCTTAC
AAATTACCAGTATTAATTTAATTCGAATATGGCTTGGAATTAGTCACAATAATTTTAAAAAATCGAATGTATTTTTATGAGTATTATTTTTTTTCGAGAC
CCCTTAAAAACCCATGCACACAGTGATGCACTTTGCGGTGTT