Description :
From Genome Similarity Track
Location :
Scaffold_1135:1052- 4572
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1135-fgenesh-gene-0.0Lipase domain protein
Pytiw_DAOMBR242034maker-piw_contig_1135-snap-gene-0.5Ankyrin repeat protein
Pytiw_DAOMBR242034maker-piw_contig_1135-fgenesh-gene-0.3Cysteine dioxygenase

Sequence
3520 bases(100 bases per row)
CGGCTGATCTTGGATGATAACCCGGGCGTGACGGTGTTCGTCACGGGCCACAGCATGGGCGGCGCGCTGGCGGTGCTCGCGGCCTACGATCTGGCCGTGA
ACTTCAGCATGAAGGTTAACATGTACAACTTCGGCGGCCCGCGCGTGGGCAATCCCAGCTTCTGCCGCCACTACAACAAGTGCGTACCGTCGAGCTACCG
CGTCGTGATGGACGGCGACATCGTGCCAGGCGTCCCGCGCTTTGTAAGTTGATGATGATGATGCTTGTATCTATTTTGATCAATTGACTGACAGTGTTGC
TGCTTTACATGATGTAGTGGGGCTTGTACCAGCACGTGGGCACCGAGGTGGCGATCGACCTCGAAGGCAACCTGATCGTGGATCCCAGTTTCGTCGAGCG
CCATCTGCACGTGTCGTCCAAGACGAACCTGGCGTCGCACCCAACCAACGTCTACCGGAACTCGATTGCCAAGTGCCTCGAGAACCTCACCTAATTAGAT
GTGCGTATCCTTCGTAGATTTTTATGAGCCAATTAACCATTTATCTTTTCTTTTTCAAGAAGATGATCAAGTTGTGCGCTCAAGCCCTGCGAAACGGTGT
CTGGGGTATCCGTTTCATCAACTGACCTCCCTTTCGGACGACTCGTGTGTGTGACTGCTTTACTCAAAGAAAGCTAATATTTCATTCGTCGGCGACCAAG
TTGCGGCGTGAGAAGAAGACAGAGCAGACGAAAATGGCTGACTATGAAGACCAGCAAGACCGTGAGGGTGTGATCCGATCGCATGTGGAGTTTGCCGAGG
CTGCGGCAAATGGCTCACGGACCATGGTACAATCTCAATCAAATTCCGAAGACTTGCATCTATTCAGCTCAGCATGGCTTTGTGTGTCGGTCTAGGTGGA
ATTTTTGCTTGAGAATGGTGCACACATCGACGCACCAGGACGAGGTCAGTCTCTATAAGTCTCCTGGCAGCTCTAGCTCTCCCTGTGCCAAGGCAACAGG
GTCGATTCTCTGCTGGATATATTGTCAGACTCACCAAATTTGCCTGCATTCAGATGGGACGACGCCAATCTGTGCCGCTGCGCTCTGGGGAAATGACTCG
ATGGTGAGCTTCCTGCTCGAGAAAGGAGCCGACATTAGCGCCCGGAACGAAGGTACCCACCTCATTCCCCAGCTACAGCTCTGTTACAACATGTATCTTG
AGCGAGTATATGGAATTATAGGAACCGGTTGGACTGCGCTGCACGCCGCAGCTTTCCAGGAGCATGGTAAGGCTGTGCGCGTCCTCCTCGACCGCGGCGC
CGACCCAAAGACCGCGGACGTTGAGGGCCGCACGCCCATCGACTATGCGAGCATCTCGGAGGCGATCTGGCCCTTCTTCGCAGCCCGCGGATGTCGTCGG
AGTCGAAAGTCCGAGCTCGTGGCCAAAGGAATTATTCGAAAGATCCAGGACCAGCCGGAGCAAACGTCCGGTGGCGACAGCAAATATGCGGAGAGCGTAC
GTGTGTTTATCTCCCAATGGCTCGCTATATCGCTATAGGAGTGATACGCTTGTGAGACTAATTTTTGTGTTGTGAATGTTATTCTGATCATTTACCAGCT
CTCGTCGTTCTCGCGACCGGGCTCGTCGTACACGCGAGCGCAATTCCAGTTGCCCGTGGCGAAGCGCCAGGGCACAGCAGCCAAGGTACGCGTTTGTTTT
TTGTTAATACGTCGAAGTGAAATTGTTATCGCATCATCTGAACCAATTTGATGTGTGCAGTCACGTGATGGAAGACCGACTGGTCCGATTGACCCGCTGG
GCGACGCGCCAGCGCTGCCGCGGCTGTCGAACCAGCGCCGCCCATCTCTCCAAGGTCTCGGTCTGTAAAGCAAAAATCCTTGAGACCCCATAGCCAACCT
AATCAACATATCGAAGGCTTCAAACCGGGTTCAAGGCATCCAACATTGAGATTCAAACTGGTGCGAGTGCTCATTCATAGCTCATAAACTCTCACCAATT
CTTACAACACTCTCGTGCATTAACCTCTTGTTTTATAATAGTCTAATAGTCTGCGCGTTCGCCGAATTCGGAGAAGTAGTATGCGTGGGCCACGGAGGAC
TTGTCGGCGTGCTCCGTGTCGAACCAGACGCGGCACTTGTCGTAAGGTGGTGAGTAGAGGTGCAGCGTGACGGCGTCCTGGCTCACGCTCGGGTTGCCGA
TCTTGTGGAGGCCCATGGAGTCGTCCATGTACGTCACGCCGGCGCTCAGCGTGGTGTTGGCGGTCTCCACGAGCTTGCCGTCGTGGCTCTCGTAGCGCAC
TTCGTTCACGGCGCCGGCGATCACTTTGACCCAGCAGCCATCGCACGGGTGGTCGTGGATCGGTGAGTACTTGCCGCGGTTCCACACGATCAGGATGAGT
GCGTACGTCTCGTGGTCTGTCGCGATGAGGTTGCGCGTGTAGTTCTTGGACGTGTCGGCATACGCGAAGCGCTCGAGCTCGCGCATGTCGCCGCTGTATC
GCCTGCATAACATTTGACAACACGGCGGCCACGTCAGTATGCAAGGCGCTACTAGAGAGCTACAAGGATAGCTCAACTCACTCGAGGACGGTCTGAAACA
CGGGCTGTTTCTTCAACGACGCGTCGCTCAGCTCGGGCTGTTTGAGCAGTCGGTCCACTTCGTCCACGAGCTCCTCGAGGCTCAGCGCCTTCTCGCCGCC
ATTGCTGTGCTGGTGCTGGTTGTCGTCTGTAGAGCCCGAGTCCGAGCGTGCGGCAGCGATCTTGCGGATCTCAGCTGTCGCTGGACTCGCTTTGCGCCGG
ACCGCCGCGCTGCCGTCACCGAACGCCATCTCGCTGCTCGTGACCGACACGAACACGCGCTCCGCCATCGCTGCTTGCTTCGTCTATGAGTGCGAGTGCA
AATGCGAGCAGAGCGGCACGTAGCGGCTATAAATGCAACCGCTAACCCCCAAAGCGTCGGCAGCACCGGCGTGGCGTTGGCGCAGCGAAGGAAGCGCAGT
GGCCACACACGCCATTCATGAGCTCTGCGAGCGCGTGGTGGCGTTGCGTTGGTTTTACTTGGATGTCATTGGTCTCGTGAGACTCTCACGTCATATTTGT
TTGACAACTCATAAACACAGTGTCTACTGCAGATATGTGACTTTCACCGTACTTAGTAATTCCAGCATGATTTAGCTGACTGCACTGAAATTCTGCACAT
ATTGTACTGATTTACGGCCTGTTTATGCTGTGTGGTTAGCACTCCCTCTTCAACCAGTGAAACGGTCGTGAGTGATGGTCATATTGGTCCTTTTTTTGCA
CAAAACGCAAAACGACTCGTTCGGGAATACGGAACGCTTACTTAAAACCCTTTTTAAAACAATTTGTGTTGTTTGTCGTGTAACATGGTAAGAATTTAAG
CCTCCTTGAAAGGATATCTGGGTGTCATCGACATGTGATTCATTTGGAAAGGTAGAAACGTCCCCAAATTAGGGACATGCAAAAAAAGCGCACCGCGCAC
AAAAAACTGCAACAAAAAGC