Description :
From Genome Similarity Track
Location :
Scaffold_198:10518- 12798
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_198-snap-gene-0.16Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_198-snap-gene-0.23Gene of unknown function

Sequence
2280 bases(100 bases per row)
GGCAGACGAAGACGTTGCGTCGGAAGATGCTGACAGCACCCACGAAGAAGAGGCACTTGACTACTCGTACCTTAGTGGCCGTCACTCGAGCATCGCGATC
GCTGCGTCGAATGCTCCGAATACGATCCGCGTTCGCAGTGAGTTGCCACACCGCATTTCCGAAGTGAGTGAGGAGGGCAGTATTGACAATGCCACGTTCG
TGGCTGTGTCGACGACACCGATGATGCGCCTGAGTGATCCACTTGAAGGCGCTTCAGACGACGGCACTGTGCCGTCGGCAAGCGACCGAGACCTCAAGCG
CCGTTCTAACACGCCAATTGTGATGCTCCCAGACAACGACACGCGCGCCAAATCCATGTTGGTGCCGTCGGTGGACTCTGCGGTGCCACCACCTTCGAAC
AAGAATGGCTCCATTGTGTTCTCTGTCGTATTTATGGAAGAGCGCGAATGGAGCTGGTCGGCTAAGTTTCTCCTCGGTATCCACGAACCAATTCGCCATG
CGCTTTTCGTCATGGATCGTTTCCTTGAACAAAGCTACAAACAAGAGCAGATGACGGTGCTGGGAAACCACGTTTTGGAGTTCTTCACGTGGTTCAAGAC
GTATTTCGTTGAGTACTTGAAGTGCCAGCATGAACTCAAGACCAGTGTGCTTCATCCTCTCATCAAGCTCAAATATTCAACCAAACAGGAAATTCTCAAA
ACCTACGAAGAGATTTACCAGTTTCTAGCACAGATCCAGCAACAAGAGCGCCAGCTGTGCACTTCGGTAGGCATGAAGGATCCATCCATATGGCTCGTGC
GACTGGAAGCGTTACAGAAGGAGATCCGAAAACTCAACATGACGCTTCACGCTGTGCTCAACTTGGAGGAGAAAACGTTGCACCCTGCGCTCAGCACTGC
GTTCACGGAGAAGACGTTCCACCAGTACGTGATGCCGCGCGTGTTCCGCTCGATCAAGGCCAAGCGCGTTGTTGTGCCATGGATTCTCGAGCGAAGCAAG
GTATGGGGTGGCGAAGCCGAGCAGCAGAGCATCCAGGGCATGCTTCCCTTCTCGGCCAAGTTCCTGTATCGCAAGATCTGGCGCCCGTACTTTATGAGCA
ACGTTGCGGGCGCAATGAAGAACCTGAACGAGTTTGTCGACAATTCGAGCACACTCATTTCGGCGGGGGGGCGGAAAGCCGATGGTGGTGTCTGCGCGAT
CCAGTAAAATAAGTTACGCAAGCGATAAACACAAGAAAAGAAAGCTGCACGACCGATGAAGCAGCAAAGGTGGGGAGGATTGGTATTCCTTCTATTTATT
TGAATTACTACGATACCCGCAACTACGTACAACATGTTGTGTGTGAGCAACGGCCACGTTATCGCGTCTTTTTGTCATGCAGTCTGTGCGTCTACATCAG
AGAGAATTACGAGTCACCCAACCGATTAACCACAAAATCAATCATCATGCCGCATTAACACACGCGTGTTTAGAGTGAGATACACACAAGCGAAATCAAG
TGTTAACCCTCGCTTTGTCGCAGTTTACTCTCTATGCCGCAGCGGCACCATCAGCACGTGAACGAGGCCAAGTGGCGACGCAGGTTTATCTCAGTTTACT
CTATTCCACCGAAAAAGTTACCATCGCGCAACAAAAAATTCACAGACCAAGCCGTGAAATCTGCTGCTTCTGCTGTCATGTGCGACGCCGCCGGCCGTGT
GTCTATCTATTTGGGTTGACGCTCTTGTATCAGTCGTCGTTGCTCGAGATCTCGCTGTCGGACACTGGATTCTCGTGCGGAGAAATCGTCGAAATGACGG
TCAACTTCTTTTTCTTCATCGTCAGCGCCCCCTTCTTCGGTTTCTTGCGATTACGCGGGTCGGACTTGGCAGCAGCACTCGTCGCGGATTTCGGTGCAGC
TGGTGCCGAAAGTGACTTTTTCGCAGGAGCACGGGAACGCGCCGACGCTCGCTGAGGCTCTGCGACAGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
TCCAGCTTTCGTGGTAAAGCACGGCGAGAACGCCCTGATGCGCTCGTTGAATCTGCTGCTTCATGCGTCGACGTCTTCGTGATTGGTATCCGAGGGATAT
TTTCCACCTCTTGCTGCTCGTTTTCCTCGTCTTCTACGTCTGCGTGCAGCTGCGTAGATGCACGAGATTTCTTCGAGGCTGGCGATGGCTTTGCGGACTT
GCTGGCACTCTACAACATGAGCATAAGAAAAGAAATGGTGAATGATAAGTTCATGGTGTTTGCCTGTAGTAAGAATAGCT