Description :
From Genome Similarity Track
Location :
Scaffold_5:105166- 106692
Transcript NameFunction/comments
Physo_128539hypothetical protein

Sequence
1526 bases(100 bases per row)
GATTGAGTTATGTCGGGGCTGATCGGCTCGGTCAGCATTGGGATCGACCTCAATGGATTGGCGGCGAGACACTCTGCACCCTGCAGAGCCTTGGCTTGAC
TTGACTTGCTGCTCGAAAGCGACGTGTTACAGCTTCTGATAGTCACGTGGAATCAGAACGCGCCCCGCGGTCTCCGCCACACAAGGAGCTGCTTGCAACA
CACCCCGACTGCAACGTAAGCAGGCAGACGCAGAAGGGGAGTCCGGGCTCTGGCAGGATACACAGCGCGGCTACCAAATTGGACCAGAAGGTGCTGTGGC
GGTGGGATGCAGAAAGCAGGGGCAATGGATACATGTACTGCTGAAGCCTGCCACAAATAGGATCCCAGAAATGGGGAATGGATTTGAAAAAAAATGGCAA
GTGTCATGCATGACGTTCATAGGGGGGTCTCGGCACGGTGCTGAGTAATTGGACGCACATCAATGCTATTGTAGACGGCCCGAACGTCTACGACTCGGGG
CACGTGGCGCCGAACTGGGGCGCCAGGTCGTTGGTGATGAGGTTGTTGAGCAGCGAGAGCAGCAGCTTGTCCAGCACCTCGATGAAGACGTTGTACAGAC
AACGACTTACAAAGCCGGTAGACACAAAAAGCCGGCAGACGAAGTCAAGCAAAGCTTAACATAAGCAAACCAGCCAATCAGATTCAATCAAATGACTTCA
TCTTTGTATACCATCTGGTTTTGTGTTCTTTATATGCTTTCTTGTGTACTTTATGCAACACGCCGTGTGTTTTATGACAGTTTTACAGATTTGACGGGAG
GGAATTTATCGTTGTTTTTATATAGGAGGATGGCATTAAGTATGCCGGCTTTGTTAGTAGTCGCCCTTCTTGTTGAGCTCCTCGGCGGAGAAGTCGGTTG
TTAATGATCTGCGTGATGAACGAGCCCGTCTGGTGGAACACAAAGTCGATGTTGGTGATCGAGTCCCAACCCAGCGTCAGCGCCGTCAGCGACGCGCTCT
TGAGGCGGAGCAGCACCTCCTCCTCGATCGTGGTCAGGTCGCTGCCGCTGAGCACGGACACGAGGATGCTGGTCACGGTCAGGTTCGAGCACACGGACGT
CGAAATGCCCTCCGCGCACTGGAACATGTCCACCTGCGCGCTGGTGGCGACCTCGGGCTCCTTGAGCGCTTGCGCGACGTCCACCGTGTACGTCGCGGGG
TCACACACGAGCGGGCGCAGCAGGTCGACCCAGCAGATCTGGTACCATTTGTGGTTGGGCTGCGCGATCTGCACTGAGAAGGTGGCGGCCACCGACACGG
TGCCGGTGAAGTTCGTGCCGACGTCGAGCGTGTCCGAGCCCGTGAGGTTGATCTGCTTGGGCGACAGCGTGGTGAGGCCCGACACGTTCAGCGAGTTGAT
CGTGGGCGTCACAGTGAACGTGTAGGATTGACTACAAGTGCTACCAAGTGTGACGGAGTCACACAGCACAATGCACAGAGGAAGTGCGTGCGGATATTAC
TATCCAGGTGAACAGCAGTTCACCAG