Description :
From Genome Similarity Track
Location :
contig_2:1051575- 1053209
Transcript NameFunction/comments
g671.t1Sodium-dependent phosphate transport protein 2B

Sequence
1634 bases(100 bases per row)
TCTGAACTGACCGGGATGGACTGTAGCTACAAACGAGTTCAAGTGATCGGGTAGAGATACGCTCGAAAGTGTGTGGTCTTTTCTCTATTGTGGTCTCAGA
CTGAGACTTTCACTTGGCAATTTCAACTCCCGTCGACACGTTTTGTAGACCATGGGGGCCGTGGTGCTCATCTCGCCCGACACTTGCAACAAGGTGCAAA
CCTCCGCGTTCAGCGACAGTTCAAATGAACTCGACAGTCCGCACTACGACAAAGGCCCGTTCGACTACGATGACGAGGATGAAGAGGACTTGGCGTACCA
GGGCCACTGTCTGCTGCACAATGCGCTCTGGGGACTCTTCTACTCGGTCGCAATGCTGGCCGCGCTCTATTTGTTCATGGTCGCAGTCAAGTTCATCGAG
TCCGGCTTCACCGTGGCCTTAGGCTGCGACGCCAAGGGCGCGTTCACAATCGCCGACAACCCGTTGGCGGGTCTCGTGCTCGGACTCGTGTCCACTGCGC
TGCTCCACAGCTCCAGCACCATCACGTCCATCACGGTGGCGCTGGTCGCAACCCAGGGCCTCACCATTCGCCAGGGCGTGTTCATCGTCATGGGGGCCAA
CGTCGGCACTTGCGTCACGTGCATTGTGGTCGCGTTCGGCCAGATCAAGGTCCGGTCTCGGTTCCAGCGCGCCATGGAGACCGCCACCGTGCACACCATG
TACAACGTGTGGTCGGTGCTCATCATGTTCCCCTTGGAGGTCCTCGCGCATCCGTTAGAGCGCTGTCGGTGCTCATGTCCAATGCCAAGACGTCGACCGG
GAGCTTTACGAGTCCCGTGGATGCACTGGTCAAGCCGTTTGCCAACCTCCTCATCCAAGTGGACACGCAAGCCATCCTGGATATCACGTCCGGTGCCAGG
GAGTGCACCGATGACGTGTCGTTGCTCTCCGGGGGTGCGTTCGAAGGCACCTCACTGACCGACGGCCAGATCGGAGCTATCGTGGTGGTCATCGGCTTCC
TGATACTCGCGTTTTCGCTCATCTGGTTCATCCAAATGCTGGCCAAAGTGTTTCTGGGACCGACCAAGGTGCTCGTGTCGAGGATGCTCGCGTTCAACGG
CTACGTGAACATCGTCGCGGGTGCGGTCATCACGTTCGCTGTGCAGTCGTCCACAGTCGTGACGTGTACACTGACGCCCATGGCAGGCCTCGGAGTATTC
ACGCTCGAACAAGTGTATCCGCTGATCGTTGGCGCCAACCTGGGCACGTGTGGGACGGCGCTGCTTGCTTCACTGGTCGTAGGCGACAGGCAGGCCGTGG
CGGTTGCTCTCGCGCATCTGTGGTTCAACGTCTTTGGCATTGTGTTGTTCTACCCGATTCACTTCATGCGTCGGCCGATCCTGGGCTGGGCTCGCTCCGT
TGCCTACTTCAGTGCGTCGTGGGCGGTAGTGGGCGTGCTTTTCATCCTGATGACCTATTTGGTCCTCCCAGGGGTGCTTCTTGGGCTTGAACAGCTTTGT
ACAGCAGACAGTGGGGGCTTGCAGGTTCTGGGATACGCGTTGTCAGGCCTTAGTGCTCTTCTGACCGCAGGTCTCCTGTTCTGGTACCACGCACGAGGTG
GGAGGAATCGGTGGCTTGCTTTCCTCGAGCTCAA