Description :
From Genome Similarity Track
Location :
contig_31:105128- 106525
Transcript NameFunction/comments
g7462.t1RAW27203.1 Alkyldihydroxyacetonephosphate synthase, peroxisomal [Phytophthora cactorum

Sequence
1397 bases(100 bases per row)
AAGTTCTGGACTACTCGGTGCAAATCGTTGTAAACGGCCGAGTCGATCGTCTTGGGAAGGAGGTAGTCATTGACGAACTCAATGATGTGTGGAAACTCTT
GCAGCAGTGGGGTGAGCGCGAACGAAACGATAAGCAGGAGTTGAGGCTTCTCCATCGTGGGGGAATTGTAAACTGGTATCCGAGCTCAAAAAATAGTTTG
ACGAAGCTAGTCAATCAAAAGGTCAATTGCTTTTATTTATATGGTTGAGGGCAATGGCTAACGTCAATCATTTGAAAAGGTCCCGCAAGTATCAATCTTC
AAATCGAAAAATGTACCCATCTTGCTTCGTCTTTCGCCTTCCGCAACTCAACCATCTAAAGTTGCCGACTCAGTCTCTCAGAATGATGGTCTTTGATTCT
ACGAGCTGACACGCCCATCTCCCTCTATTCAGTTCGCAACGTATCCGCTCAGTAGCAACAACATGTCGGACGCGACGCCGTCCGTGGCGCGTATGCGGGC
CATCCTGCGCCAGCTCTCGGCCGGAGGTCGTCCCGCCGCCTCCTCCTCCTCTTCCTCCGCTTCCCCTCCATTGGCACTGAGCCCCGCCACGCGCTGGAAC
GGCTGGGGCTTCCAGGACACGAAACTATTCGTGAACTCCAGCAATGTGATCGAAATCTCGGGTGCTCGCTACGCAGAAGTGTTCGCCAATGCGCCAGACC
GCACACTGCCGGCTCTGCTTCCATGGGCGGAGAAGCGGCTCGGTCTGGACGCGGGTCGCGGCAGTCCGCCGAGCGTCACGTGCGCTGGGGAGCTGCAGCT
GCAGAACCAACTACCAGAGGACGGAGAGACGCACCGCAAGCTGCTGCAGCTGCTGCAATGGGCAGAGCAAGAAGTCGGCATCAAGAGCAGCATTACAGTT
GAAGAACGCGTCCGCCACGGCCACGGACAGACGTGTGAGGACGTTTTCCGACTGCGCCATGTGCAGCAAGTGGAACGAGTTCCCGACGCGGTGCTGTGGC
CCTCGAGTCATGAACAAGTGGAGGTTTTGGTCAAGGAGGTGACGGAGAAGTTTGCACACCAGGTGTGCATTATTCCGTTTGGAGGGGGCACCAACGTGAC
CAATGCGCTCGAGTGCGACCCGAAGGAACGACGGGCGATTGTGTCGTTGGATCTGGGCGAAATGCGACGCATTCTGAGTGTGGATCGGGAGAACATGTTG
GCGGTGGTGGAGGCCGGGATCACCGGACTGGATCTGCATGAGCGGCTAAGGCATCGAGGCCTGACGCTTGGCCACGAACCGGACTCATGGGAGTTCTCGA
CGCTCGGAGGGTGGGTGGCGACGCGCGCCTCCGGCATGAAGAAGAACACGTACGGGAATATTGAAGACCTGGTGGTAAATGTTACGACGGTGACGCC