Description :
From Genome Similarity Track
Location :
Scaffold_2:1051030- 1057822
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000802Similar to BAZ2B: Bromodomain adjacent to zinc finger domain protein 2B (Gallus gallus)
Pytul_DAOMBR144PYU1_G000801Similar to chd8: Chromodomain-helicase-DNA-binding protein 8 (Xenopus tropicalis)

Sequence
6792 bases(100 bases per row)
ACGACAATGGCGGTGGACGCAAGCGTCGAAGGAGCCTGAAAAACGTCAAATACGTCCAAGATGATGGCTCGGACGTCGAAGAAGTCGTCGCGGCCGAGAA
AAAGCGGAAAGCGCGTCAATTGGACTATCAAGTCCGACCGGTGCGTCATCACGCTAGCAGCATTCGAACACGTTAAATGGACCACTAATATGCTGACTGA
CATGTTTTTTCGTGATCTAGGACGCGGAATACCCGGAATTGGACCAAATCGTTGGACGGCGCATCAACAAACGCAGTGGCTTGACGGAATACCTGTGCAA
GTTCATTGGAAGATCCTACCTGCACCTGTGGTGGCTGACGTTTGACGAATTGGAGCTCTTCATTCCTGAGGGCTACCAGAAACAGCACCGTGTGCAGCTC
TATGACCGCAAATTGCGCCGTGAAGGGTACCAGGATTTCGACGATGTCGATGATCTCGAGGCCAATAAAGTGACAGTGGAGAAGATTCTGAGCCATCGCG
TCGATTTGCGCGACAAACTCGACGACCAGATCGAGAAGCGCCGCCAAGAGTTTTCATTTGCGCCTCGATTTCCGCGCGTGACGGATTATTTCCTACTCAG
CAATGCCGATGTGCTTCCAGAACGGATGGTGGGGATCGTGAAGAAGCTCTTGAACGAAAACGGTGGTGAAGTTTTCGAGCATCCAGTCGACACAGAGTAC
GTTCATGTTATAATGTGCGAGCCCGCTTCCACATAGTGTGTTAGTGCTTATGGGCTAACGACATTTTTTGTTTTGGACTGTTTCGTGTGATACTTGTAGA
GAAATCCCTGATTACCTGAACATTATCTTGAATCCGATGGATTTGGGTACGATCGCGGCGCGGCTGGCACGAGAGAATTATTATATTGGGCCGGCTGCGG
TGTCGCTGTTTATATCGGATGTGCGCCTTGTGTTTGCCAACTGTAAGGAGTTCAATGCCGCCGAATCCGACATTTGGTTGATCGCCGACGATCTTTCGAA
AATGTTTGAAAAGTGGATTTATGACTGGGTCTTGTGCCCGTCAGCGTGGCTAAAGCTCGAACCAGCGCTGGACAAAGAAGCAGATAAGAAGCTGCTGGAC
GAGTTCCGAGAAGTTGGCGAAGATAGCTACGATCTGTGGTCGCCATGGGAAGTTGGGTGCTCGATTTGCCGAAAAAACGACAACAGTGAGCAATTGCTGC
TCTGTGACCGATGCGATGGGGAGATTCACATGTACTGCTCGACGCCTGAGATCACGGAGCTGCCTGAGGGAGAATGGTACTGTGCGTTTTGTGAGGTTCG
CAACAAATTTGAGAAAAACGCAATCAGCGCCATTGAGGAACAGACAAAGCAACGCGAAGAAGCTGAGATCGCGCAGTCAAAGGAGATGAAAGGGGGTGCA
GATGCTGCTGCTGGGCATAAAGTCGACGTCAAGAGGCCGATAGCTTCACCAAAAAAAGCGATAACCGCTCCGACGTCGGTAGCGATTCCAAGTATCCTAC
GCCAGCAAGTCGGAACGGGAGACAAAAAGTTCAACCGTAAGACTGCAAATACTACTGCTACAGAGAGCGACGGTGATGCGCTAACTGCCAAAATGGAAAG
TGGTTCCGCGAATCCTAACGATCGCGCGACCGTCTTCCTCGTCAAGTGGCTTGGTGTATCCGTAAAATATTCAACATGGGAGCGACCAGAAGATATCGGA
GATGACGAGCAGATTCAACGGTATTTCAAGTTTAGCCGCGTTCCGACTGCCAAAGAAATTATGGAGACCACATGTCAATTACCGTGCTGTGCAAAGAGGA
ATCAGTACTTGCTCTACAGCGGCACTCAAAAATGCTGTGATAAAGATCGATTCTGCACTCTTGGATGGCGACATGAAGGTGACTGCAGCCGTGAAATCAA
GTCTTTGGAGAAGGCTTACGGCACCAAAGAGTACCTCAAACTGAAAATGGTTGAGCAAGTGAAAGCGCAGCTGTATGCCTTCCATTGTTTACTGAACAAC
CACACACCAGATAAAGACGTGCTCAAGCAGTGTGGTGTGTTCACGAACGCGTACGTTTGCAAGAAGCAGTATTTGATGGGCACAGCGAAAAATTCCAAGG
ACGAGGAAGACGAAGACTACTCGGAAGACGAAGGCGAATCGTCCGAGGAAGAGGAGTACGATGACGATGAAGTTCCACCGTTTCGCCCTCAAATGTACCC
TGGTTTTGTCGACAACGTTGACGATGGTGATGTTGACTTTTTCTCGAAGAAGAAGCCAGACGAGGAGGTCAGCGAAGTTGTGAGTTCGCTTGTCGAACAC
ATTGCCTTTGGATACCCGACCGAACTTGTTCCTGTGCCTCTAAAGGTGAAGTATACCTCTCAGTTTCAGCCAACCAGCTTGAAAGGCCTCCCGACGTTCT
GCGAGTATCGTGTTGCCTTGCGACGAACGCAATTTGGCCTTGGGATGCGCTTAGGTGTCGCGGACAACGAGAATGCATCGGTGCTGGGATTCCAAAATCT
ACCAAATGGTTCGATTGGACCGGCCGAGGCTTCGCAGGTGATCTCTGTGGGCGATGTTCTCGTTGGTGTAAATAACGTGTACGTCGGTGGGATGTCGTTC
AAAGATGTGATTGCAGTGATCGGCCGATCTTCGGAGATTGTTCTCTTTCATTTCCATTCCCGACGTGCTGCGTACATGTATCCACCATACTGCCAAGCTA
GACAAGCGATACTGCAACGCGAAACTACGCTGGAAGGTGCAGCCGATGAATCGAAGTTCATCAATTACAGTTACCACAAGTACAAACCAATGCTGAAAGT
TGGCTCCACCCCAGCCTCATCCGTGCCCTTGGCGTCTCAGGCGCTCGCGAACCAGGCAAACTACATATCACCAAATGGCCCAATGCAGCACTTGTACTCA
GGCATCATCGACAACAGCATTGATCCACACGAGCACTTTGCCAGCTTCCTTCCTGCAAAGCGAAAAAAAGACAGTAAGGCTGACGACGGAAGTGGGAGTG
ACAAGAATGAATTCATCCCGTACGAGCAGTCTCCAACGTACAAGGGTGGCAGAACGTTGCGCGAATACCAAGTGGAAGGCTTGAACTGGATGATTTCGTG
CTTCAAAGCGCAACGATCCACTATTCTTGCCGACGAGATGGGTCTCGGAAAAACGGTTCAAGTGGTCTCGTTCATTGAGCATCTGAAAACCGAAGAGTCT
ATCCGCGGACCTTATCTGATTGTGGTTCCGCTCTCGACAATCCAACATTGGCGGCGTGAAATCGAGAGCTGGACCGACCTCAATGTGTGCGTCTATCACG
ACATTGGGGATCGAAGCAATCGTTTCACAGCAAAGGACATGAGAGGCATCATTCGAGATCAAGAATGGTACTATCCAGGGCTAGGCAACTCGATTTTCAA
GTTCAATATCTTGCTGACGACGTTTGAGACACTGCTGGCTGATTTTGAAGAGATGGAGCAAATTCACTGGCGCTTAATCGTTGTTGATGAAGCGCATCGT
CTGAAAAGCTCCGGGTCGCGTGTGCTCAAGCAAATGCGCTCGTTCCGTTGCGACCGCAAGCTGCTACTCACTGGTACCCCTCTTCAGAATAATATTCAGG
AGCTGTGGGTGCTGTTGAACTACCTGGAACCGGTCAAGTTTGACAATATGGAGGAGTTCAATGCCAGCTTTGGCAAGCTGATCTCACAAGAGCAAGTCGA
AGAATTGCAAAAGTTGCTGGGTCCGTACATTCTCCGTCGTGTAAAAGAAGACGTTGAGAAGAGTATTCCGCCGAAAGAAGAAACGATTATTGCCGTCGAA
CTCACGACGCTGCAAAAGCAGTACTACCGAGCGATTTACGACAAGAACAAGAGTTTCTTGTTCAGAGGCACCAAAAACTCGCTCCCGACACTCAACAATA
TCCAGTTGCAGCTTCGAATGTGCTGCAATCACCCATTCCTCATCAAAGGAGTTGAAGATCGAGAATTGGAGGAATTGGGTCCACGTCCACCACCTGCAGA
TATCATGAACAAAGTCGTTCAATGTTCGGGAAAAATGGTTCTGGTCTCCAAATTGCTGCCAAAACTGAAGGCGGAAGGCCACAAAGTCTTGATTTTCAGT
CAATTCTTGAAGCAACTGGACATGCTAGAGCGCTACTGTGAGTTTAATGGTTTCGTGTACGAGCGACTTGATGGATCGACAAGTGGAAGTATGCGCCAGA
ACTCTATTGATCGTTTCTCTCGCGCAAACTCCAAGTCATTTGTGTTCCTGTTGAGTACGAAAGCGGGAGGTGTTGGTATCAACTTGATCGCTGCTGATAC
TGTCATTATTTTCGACAGTGACTGGAACCCCATGAATGATCTCCAGGCTCAATCCCGATGCCATCGAATCGGTCAAAAGAAGTCTGTACAAATCTACCGC
TTGGTGACGCGCAACACGTACGAAAGCGAGATGTTTGACCGCGCGTCGAGAAAGCTTGGGTTGGAGCATGCTATCCTTGGTACCGCATCGTTCAGTGAAA
CAGCCCAAGTCGAGAAACCGTCTTCGGAGCAGCTTGTCGAGCTCCTGAAGCGTGGCGCGTACGCGTTAATGGAAGAGGACGACACAGCATCGAAGGAGTT
TGCAGATCGTGATATCGAGACCATCTTGAAAGAAAATGCACACGTTCGTGTCATGGATCAAAATAAGGGCGATAAAGATGGAGAAGAAGGTGGTGGCGAT
GCAGCAGTGGTCCCAAGCCACATGCGGAAGGTACCGACAAAGAAACGAGCTCGTAAATCGCTTGGAGGTATGGCGGTTGATCGATCGTCGTTTATTGCTG
AAGGCTCGACTGGTGATCTCTCGGTGGATGACCCGAACTTTTGGGAAAAGGTGTTGCCTGGTGCTGTGTCTGTCGAGATGCTGTCTTTGAAGCTTGAAGA
TGGAAGTGCTGTCAATTCACGGCAGTCAAAGATCAAGTTTATCAGCAATTTAGACATCGCGTTGACGGAGTTGGTGAACGAGATGAAGAGCGGAAACGAT
GATGACATTCGATTTGGAGCGAAATTTGAGCACGAGTATGACATTGCGATCCAGATTTTGCATGCAGTCACGACGAAGTACAAGAAAGAGTTTTCGACGG
ACCAGCTGGATTTAGTGAAAGGATACCTGACGAAATTGGAGAAATCGCGTGTGCGAAGCTGTCGTGTGGCTCCAGCCAAACGCGATGCAGACAGCTCCAC
TCCCAGTAAAAAACGCAAATCGAAAGCAGGCATGTACGGAAGCGACGACGACGAACTTAGTCTCGACGACGATGACGAAGAAGCTGATGCTACGAAGGGG
CCGAAGAAGAAAGGAAAACGTGGCCGTCCTAGCAAAAAAGACCTTGCTAAGGGCGCAAAAGATTTGCTTCGAGGCAAAGCAGGAAACGCCAACAAGAAGA
GAAAGGTCTCGGACGTGGTGGAACCAGTTCCGATTCTTTTCGAGGGCGGCGTGATCAACGACAGCGACGACCTATGCACACTTTGCGGAGACGGTGGCTT
GATTCTATTGTGTGATGGTCCGTGCCATCGGTCGTTTCACTTGGAATGCATTGGGATGACGGAGGAACCCGATGATGACCATTGGTTGTGTCCAGATTGC
TCTGCGGGACGTCACATGTGCTTGATTTGCAAACAAGTGGGCGAAATGGGTGCCGAGTTCGGTGTCATTCAGTGTTCGATGGCCAAATGTGGGCGCTTTT
ACCACAAGGGCTGCTTGGTAAAGCACCCGCGAGTCGAGTGGGTTGGGAAGAAGCGATTCCGTTGTCCAAGTCACTTTTGCCACGGCTGTTCGATTGATGT
GCAAAAGAAGGCGACGAAGAAGCCCGTGAGCGTGGTTAGCTGCATTCACTGTTCTGAGGCGTTCCACCCTCACTGTATGAAATCAACCGAACAGTTTATG
CGCTTGTCGGCGAACCTCATGATCTGCGCGACACATTTGCGTGATAAGAAAGTGCTCACGCCAGTGAAATCGGCCACTAAAAGCAGTGTTGGTAATGGGA
CTGCCGATGATGGGACGGCAAGTCCGGTGATTGCAGCTATTGACGTTCCAACCAACGGTACAAGCGATCGCGTAGACGACGAATCGGAGCAGGAAGCTGA
CGATGAAGACAGTGCATTGATGTCGGGAAAGCGCAAACTTGTGCCTATCCCGACGGTCAAGATTTGCGGATTTTGCCATCGAGGCGAAGTTACGCCAACG
GAGGCTGCACCAGCCGCAGAAGAAGAGATGCTATCGAGTAAATCTCGGCGAGTAAGTCGTTCGCCAGCAAAGAAAGCAAAGGTTGAGGTTCCGCCTGCTT
CTATCGAAGGCGCTTTTGTGGAAGCTCCAGTGCGGTTGCAGCTTCAGGACAAGTCGGTCGAGATGGTGTTTGTGCATTTGAACTGCGCGCTGCACTCTCC
CGAGGTGTACGTCGAAACGAACGGTGTGTTTCGCGCCCTGCCACGCGCCCTGAAGCGCGGACGTCAGCTGAAGTGCACCAAGTGCAAGGAAACCGGGGCA
ACCATTGGCTGCGTTGTCCCGAAATGCCGGTGCAATTATCACTTGCGGTGCGCACTGGAGAGTGGTGGCGAGTTTATTGACTCGCCGTACTCGCTGTATT
GCAAAGAGCACGCGGCTGAGAAGCATGCCGAGCCAAAGAGTTTCTGTGTCTGTGGTGCCAACGACCCAGCCGATACGAGTTTGTCGCTGCAATGTGCAAC
GTGTGACTTGCGATACCATCCAAAGTGCGTCAACATGTCGGGTCGCCAGGCGGCCAAGAAAGCAAAAGCTTCATGGGTTTGCCAGACGTGTG