Description :
From Genome Similarity Track
Location :
contig_109:105098- 106403
Transcript NameFunction/comments
g13692.t1ETM36639.1 hypothetical protein L914_16715 [Phytophthora parasitica

Sequence
1305 bases(100 bases per row)
GGGGACATTCTCGGAGCTGTTCATGATGAAAGCCACCGACGCCTTGCTGCTGGTCGCCATTGCACTCAGCTCGATCGACGTCTCTTTGACAAATGGATTC
CTTGCGTCGAGCTGGGCGAGATCTCATTCCTGCATCAAGCTGAGGCCGCCGGGAAGCGTCACTTTAGGTAGCGAGCGAGGATGCAACTGCTGACCAAGCT
GCTGCCACGCGGGCCGCGTCGTGTTTCACTGTCATATATTCCGAGGAGCGTGTTATCTATTGAGCTATCTTACGCTGTCTCCTCGACAGCTTCGGGCTTG
GAGAGCTTGGCGTCGAGCTTGACGAGCATGTCCTCAACCATGCTGTCCAGGTCAAAGTCGTGCTGCCAGCCCCAATCCCTCCGGGCGATGCTGTCATCCA
GCGAGCGCGGCCACGTCTCGGCGATCTGCTGGCGGAAGTCGGGCTTGTAATCGCACTGGAAGCTCGGCATGACCTTCTGGATGGACGCCACCATCTCCTC
GGGTGTGAAGGACACGGCCGTGATGTTGTACGTGCGCTGCGTCAAGCAGTCGTTGGGTGCGTTGATAAGCCCCAGCGTGGCCTTGAGGCAGTCGGGCATG
TACATCATGGGCAGCTTGGCGTCCGGCTCGAGGAAGCACGTGTATTGCCGTGCTTGAGTGCGTCGTAGAAGATCTCGACGGCGTAGTCCGTGGTGCCTCC
GCCAGGCAGCGCCTCGGACGAGATCACGCCCGGGTACCGCACCGAGCGAAGTCCACGCCAAATTTGTTGTGGTAGTACTCGCCCAGCAGCTCCACGTGCA
CCTTGGTGAGTCCGTACATGGTCGTGGGGCGCATGATGGTCGTGTCGGGCGTCTCGTCCTGCGGCGTAGAAGGCCCGAAGACTGCAATGGTGGAGGGTGC
AAATACCCGCAGCTGGTACTGCTTGGCCAGCTCCAGCACGTTCTGGATGCCGCGCGTGTTGACCGCCAGCGCCAGACTCGGGTTGGCCTCGCCCACGGCC
GACAGCAGCGACGCCATGTGCACGATCGTGTCCACGCCCTGCTCCGCCACGATGCGCGCCATCGAGTCGCGGTCCTGCACGTCGCAGTAGACGAAGCGGC
TGTCACGCGGGCCCGAGGGCGCCTTGATGTCCGAATTGACGATGGCGTCGGAGCCGAAGAGCTCGCGCATGTAGGGCACGAGCTCCATGCCGATCTGACC
CGTGCCGCCCGTCACGAGGACGCGGTTGGCGGCTTGGGAGAAGGCCCGCGTGGATGGACGAACGGCGTTGCAGGCGAGTGGCCGAGATCATCTTGGGACG
GAGAC