Description :
From Genome Similarity Track
Location :
scaffold_64:105093- 106196
Sequence
1103 bases(100 bases per row)
TCTTTTCACTCAGAGCCGATATTCGTTTTCTGAAAGGCTATGGCATATTATGCCGTTCTATAATAAGCGAAATGCAGCCACAATTCCGGCGCATACGCcg
atttttgaaaaaaaaaggCTGCAGAATAGCAAAGTCAAGTGTACTTTGTTCTGTGCCCTTGACCTGGCCAATAATTTTTATCAATAGCCGTTTAAAGGTA
GCAGTCTCTCTCTCACTACGGTGTAAGATTCTTGCGGGATGCGCTAGAATTTGTGGGCTATACTACAAGGACTGCCAAATGCAGCATCAACGTttcgcct
tgcgcagcagcTGCTCAAACATATGGTGGCTTTGCATATACCCATCTCGGCGTTAGATTGTTCCAAAGCCTTATAGTGCTTGGTGAGTTGGATACATCTA
AACACTTGCATAATGTTCAAGTTCATGCGCTTAAATTAGCAGTTTTACCAGTGTACACATGTCTTTCTTTGGCGTCGATGTATATTCTAGCTCTGAGTGT
CTTACTGGGACGCATGGTCTGCGAGCACAGAACCCAAAAGGCAAAGGCCTTGGTTGATTTGCCAGTGCCTCTACCCCAAAAGAACTTCAGAAAGTGGTTT
GGTCtgaccaactacttgcaaaaaTACGGCACGAACCCCGACATGGCACCAACCCTCATTAATATTTCTTCCTGAATATATGTCAAATTATGTTGGGCGC
GGCAAAAGAGGCGGTATCCAAGGCTGTGGAACAGGCCTCAATTCTGGCCCTTATCCAGATCGGACATTCTATGTCGGTTGTGACGCTTTAGCCTTCGCGA
TAGGGTGCAAGCTGATGAAATGAACTTCGATAGCATTAAGTTTCGCCAACTTAGAACAGCAGAGAAAAAGTTTCTTGTTTCTTACAAGGCATTCCTTGCA
ATAAAGTATGCCCTCGGCAGGTTCAGAGTGGACCAGCTTGTCttgaagccgtttgtgatctgtacaaatcatgcgtcattgcgCATAGCGACGTTGCCAC
CTTATCGCTTGCAGACGGTGGCAAAAGTGCTAACCCCTCTTTGTCGAGTATGGCTTTGAAGTACGGTGTAAGCCAGGCGACTCAGTGTGGTTGGGTATGC
GCT