Description :
From Genome Similarity Track
Location :
Scaffold_165:10508- 11986
Transcript NameFunction/comments
Physo_144077hypothetical protein

Sequence
1478 bases(100 bases per row)
CAGGCGGAAATCGTAACAGCGATTCTTCCTCAGTGGACGGTGGCGGTTAGACTCCAGGATAGTACGCAGGTAACGATCTCCATGTGTCTCCCGGACTTCC
TGACGCTTCTTCCTCATTTCTTCTCGAGCTTCTTTTGGGTCCGCGTCGAACAAGTCGAAGAACTTGCACTGCTCTAGGACGATGGGTTTGCTGGCAGAAG
AAGGCGGGGGACACGAGGGATACTGCTCCACTAGGTCCTTCGACGTCAACGTTGTGCCAGTTCGAGCCAAAGCGGTGGTGAATGCCGCTCCAACGTCACC
CCCGCCCATCGTTTGGTTTGGTTGCTTCGGCTCAAGCCTGGTACTTGTGCGTTTCAGGGCGAATTGCAAAGTGAGCACGCGGAAAACAAGCTGTTGATTA
GCTGAAGTGGACATGGCTCACCAGCAATCACTCTGATCTTGAATCGTCTTCTTTCAATTCATGGTTGAATCGCGATTCTGAATTGCACAAGGAGAAGTTG
AAGTTGAAGTGCGCATTTTGCGGATACCGCAGCGGAGCATGGGGCGGCGAGCACGCGAAGAGAGCGGTGCGTTTCCTCTGCTTGTGGCGCTTCCTGGCCC
TCTGCACAGTGTACACGGCGACTCAACGACCGTTCTGCAGCAGGAGACAGCGTCGACATCGAGCGCCGTCGCCGCAACAAGCAACTGAAGCTGCTGCGCG
ACGGTCAGAGCGTGAGAGCCCAACTGCCATCTGGATGGGGAACTAACGTCAACGTCAACGCCGCCTGCCGCCTGCACAGATGAGGGCTGCAGTGGCGTCG
ACTGGAGCTGGAGGACGTTCCTGCAGAAGCTGCACTTCTTCCTGGACAACGAGACGGAGGGGGATTCGCTCGCGTGGCTTGAGGACGGCGTCCACTTCGT
CGTCCACCAGACGAGTGAGGCGCCGCTCGAGACGTGGCTGGGGCTGAGGGTCTGCTCGCTTCACCAGGTGCTGGAGGCGCTCAACTTCCAGTGCAGAGAG
GAACTTCGCTGGGAGTACGTCATCTACCACCACGACTGCTTCGTCCGGGGTAATCCACTAAAGATCAAGGAGATGCTGCAGCCAGACACCTCGGCGGTAT
CTAGTAAGGCAGGGGGTATGACGATGCCCAACGTCACTTACAGCTCGACACTGAAGCCGCTGGAGGTTCGATTGAGTCTGTCGGACTCCCACTCGCAGTC
TTGGGAAGTCATGATCGCACCGAGTGTCCTGCCCCACCCCAACTTCGACGTCCCGGAAGCTTTCAAAGTTGAAGAGAGTTTTGGTGCCGGAAACAGCGCC
GACGAGACCTCGTGGGACGACGTGTTTGACTACTCCGATGAGTGGAGCGACCACGACCTCAGCTCGCCGATGTGGTGGTCCCAGCGCAGCGACTTCTCCA
GCATCTGCACGGATGACCTGTCGGACATGGACACACTCTCTCAGCTCAGCACGTACTTCGGCTGACGTAGGGGGTTAT