Description :
From Genome Similarity Track
Location :
Scaffold_72:105076- 106144
Sequence
1068 bases(100 bases per row)
AATTCGGACGATACTTCCACGACAAGTATCCTGGGGTAGCAATGGACACTGTTTACAACGCTGACGAAACGGGAATGTACTACGACATGTGTCCAAGTAC
GATTTGGGCTGTTCGTGGTGGTGGTAGTTATGTAGCCAACTCTGAAAGCCACTCCTACCGTATGACCGCGCTGCTCACGATTCGTGGAGATGGTGCCAAG
CTGCCGATTCTTTTTGTCATCCGTGGCAAGGCTGGTAGCGGTATTGAGACCAACGAATTCGACGACTATCCCCCGGGCCACTTCTACGCCATGCAAAAGA
AGGCGTGGATGAATGGATCGGTATGGAAATACTATCTTCGTGAGGTGCTCCAATCAAGCATTGAAGACCCATCAATTCTCCTGGTGGATAACTTCGATAG
CCATGTCAGCGAAGAAAGCGAGTGTATTGTCCGCGACGAGCTTGGAAGTGAACTGTGTCCACTTCCACCAAACAGCACTTCTCATTGTCAGCCGTTGGAC
GTTTCTATTATGGGACCGTTCAAACAGCATCTGCGTGATTTGTGGGTTGTCACTCAGAACACTGCAACAACTGCAAAAGCAAAGCGCATTGCCATGATTG
AACGTGCAATTAAGGCGTGGGACATGATTTCTGAAGACGAATCTTCGTTAAGGCCTTGCCGAAGTCTATGTAGATTTTAGAATTAATGTTGAATACTCCA
AATGATTGTTTTTATTTTTTGTTTTGTACTTGAAATTTGTATACATTTTTTTAACCTCGGCGAGGATCGAACTCGAGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN