Description :
From Genome Similarity Track
Location :
contig_46:105070- 107697
Transcript NameFunction/comments
g8179.t1hypothetical protein

Sequence
2627 bases(100 bases per row)
ATCTGGTCACTAGGCTGCGTGTGTGCGGAGCTGCTTCTGGGACAGCCGTTGTTCCCTGGAGAGAGCGGTGTGGACCAGTTGGTGGAGATCATTAAAGTTC
TGGGCACGCCGCAGCGTGAGGAGATCGAGGCTATGAACCCGAACTACACGGAGTTCCAATTCCCGCAGATTAAGGCCCACTCCTGGAGCAAGATTTTTCG
TTCACGAACCCCTCCCGAGGCTATTAATTTGCTGTCCAAAATGCTGGTCTACGACCCGAAGCGGTGAGACGTCGGAGTCTGATTGGGTACCTCTATGGGC
TCCACGGCTGACTCGCTGTGTTGTGTGCGTGTGTGAAAACTAGACGTGTGAAACCGCTGGAAGCTGCAGCGCACCCGTTCTTCGATGAGTTGCGGCACAA
GGATCTGAAGCTGCCAAATGACGTCCCCGCGCCTGCACTGTTCAATTTCACGTTGCAAGGTACGCAAACAATATGCACATGTCTACCTATTACCGAGCCT
GTGTAACCCGAGTCCGTGTTGCTGTCATTTTGCACAGAGCTCTCGCAAGTGGACGCCGCAACGCGCGAGATTTTAGTACCGCTTCACGAGCGGAACTCCA
CCAACTGGCCGGTCTTAGAGGACGGCACGTGGCCTGATGCGGCAGCTCACGGGACTTCCTGAAGGGTTGTTGTACATCAAGCAAAACATGAACGGCCCAA
GGAGACAGCAATGGATTTGACCGAGGGAGAAACCAAATGTATTTTGCTTGTATCTTTAGTGGGCCCGGAGCTGTTACACGTTGATGGCTGTGGTTGTACA
GTACCTACTAATTCCGCACATTGGTGCAACCGTCCTGGTATCGCACGGGTGAAGGCACAGGTGATACATTTTGCAGGCCACGATCTCATAAGGTAAGGAT
GTTCGTGGTGGAACTATCACTGCTGACAACCTCGCGAATGCTAGTGAGCGGGTGCACTGCTGTCTGCCCAAGCAGTGTGCCTCAGGCCCATGGCGAAACC
CTGCCGATGTGTGAAGCCGTCGATTTCGAGTTGCTGCGGCACCTCAAGTCAGCAGTGCCCCAGCAGAGGAATCATGAGAGGCGAAAGGAAAGCTTACCTC
CGTTCTGAGCTGCCCCGTGGAAGGAGTCGGAGCCTGCTGCTGATCTGCTACTGTTGCTGAGTCCCAGCGAAGTTTGAGGTCGGACTCGCTCTTTCTCGGC
TGCTTTGGCTTGCTGGAAGTGCTCCTCCCACTCCTTTTTCGTGTTCTTGATGTCCTGCGTGGAATTTGGACGCCAATTTGTTAGTGGATGGTCAAGTCTC
TCCCGCGTACTGTAGACCACGACACAGAAGCGTACATTTCGAATAAGCTCGAGTGAGACCTCATTCTGCAGAATAAGCTCTGTCAGCTCCACATCAATCA
GCGCGGATTCATCGAGTAGCTATGGCACACGTTCGTGAGGATCGTTCGCAAGATATCAGTGGAGGCTGCAAATCACCAGTATGACACTTACCTCTGAATG
AGCTAACCGCTGGGGGCTGTCATGACGTCGTTTTGGTTTTTCGTCACAGTTGCTTCCTCCCCGCCTGGCGGTATTCGAGGAGATTCATGCATTAAGCGAT
TCTTCGGTCTCCTGAGTTTGACGAAGCAGCATTTCTCTCAGCCGTGTGTTTTCCCTCTGCAGACTTGCATTGTGTTGCTGCAAGTGCACAAGACTCGGTG
TTATCGCTTCGATGCCAGCTTGCCTTTTCTGACAGTACGAACCTCTAAAGATTTAACCCGCTTTGTTTCAAGCACACGAGTTGCGCTGGGGTCGCTTTCA
AATACGGCCAATCGCTTCTTTAGGTCCTGAACCTGTTCCTGGAGAATGGGGATGTTGTTGTTCTCCGTCTGAAGGTGCTTGTTTTCCTCCAGCAACGATT
GACTAACGGCATCAAGCTGATGTTCTTACTCGTCGCTAGCGTTTCCTATCATTGTGAACGGACCCAACAGAAGGAGCAATAAGCAAACACGCTGGCCGAC
CGGAAGCACAGACACGTAAGTGCTTACCATCAATACTTCGATGTGCTTCAGCAGTTTTCGGATCGTTGTGTTGGGGTCTGACGGGTCTACACCAAGATGT
GAAGTCGAAACACTGGGAGACAAGCTCAGTTTCTTTAAATCCCCCAAGATCGTGGATTCTGCGAGGCATCAGCAGCAGCCTCCACCTCTCTCCCTGACAA
CGGGTTAGCACTGCGCATTTTATCGACAAAATTGGATGCTGTCGGAGAAGTATCGGTGTCAACGTCCTCGTCACTCGAAAGTTTGGCGTTAGCGTGGTTG
GCGGCGGCCTCCACTTCCACTGTCGACATTTCACCAGCATCGTCGGCCATGTATTCCAACAAAATCGGATGATTGTTGAGAAAGTCATCGCGGAACAGGC
GGACATTACCTCGAGGCATGAGATTGCTCGCAAAAGGATCGGTTCCATTCGACTTGAAGCTCGCTGCGGTAAGGCTTCCACGAGACCCGGCGCCAGCAGG
AGCTGTATATGGCCGAGCTCCGATAAACCCGTTGTTTCCCTCTCGTGAGCTCTTGTGCACCGAGGCAAAGAACTCTTCGGTCAAGTCTTTATCAAGTTGC
GTGACCTTGTCCCCGTCTAACATCTTG