Description :
From Genome Similarity Track
Location :
contig_2:1050592- 1052604
Transcript NameFunction/comments
g747.t1RAW38994.1 hypothetical protein PC110_g4754 [Phytophthora cactorum

Sequence
2012 bases(100 bases per row)
ACTCAACAAACCGCCCACACCGGATGACGACAGCTCCGATCGCAGGCAGGGTGACTGAAAACGGCGTCTTGGGTCCATGTTCCAGTGCCTTTCCTGCTGT
AGGATAAGTGAGGATAGCATTGTTGGATCCATTGATCTTAATCGAGCATGGGACCAAAGCTGGAGATGCCATTGGCAGGCAGCGCAGACCAAGCTTGCCC
ACGTACGAATCACCTCTCGATCCAAAGAACGAGCTAACTCTCCACCCGTCAGCAGCTTGCAGCGCATGCAGTTTGCCTCCGGTTCCACCAAACCAGCGCG
AGGAGCGAACGTTCGTGTGGAGCTGAAGGCCGTCGATCCATGCCATGGCACGGACATCCACGCGAGTGATGCACTCTCCAGCAGCCAGAACGAACCAGTG
TTTATCTCCAGCAGCACGTAGCGGCTCGTTGCGCTCCATTTTCACTACCTGCGCGCGCGTGAGAGTCTCCAGGCGGTTCACGTACTTTCCAGCATCGACC
ATCACGGCTCCAATTTCATCAGCTCCAGACATTGATGGTTTGTTCTCTGGGAGGTCAAGCTGCGTGCCGTTGAATTGGCCATTTCCCACGGGCCCGCGCA
CGGAATCGTCCCAACTCACAGTGGGCCCTACAAGCGACGGCTTTGCGTGTCCAGAGATCCACGGGCAGTGGCGTAGCAGCTGCGCAGACGCAGAATTCCA
ATGCGCTCCTCCACGGCTGGTGACTTCACGAAGCACTGCGTGGTTCAAGCCCAGCCACCCTTGCGCAGACGCCTGATGGAACCCCATCTGCGACGAGCGC
GGGTCCGCTTGGTAGATACACAGAGCCTATTCATGTCGTCAAAGCCGCGGGACATGATGCCGCTCGTAGCATGGCCAAGTCCGAACGTGTGTCCAATTTC
GTGCAGCATGGCGCCGATTCCAGTGGAAAAGTTGGCCCAGAGCGTACCCCTGAAGCAGCTATCATCCAGCAGGAATCGCTCATCAATACGAGCGTTGTTG
AGACAGCAGGCAGATATCTCACTCAAGTGTGCAGGCCACGCGTGCAGTCCACACGAACCAAACACGCCCACCTTCCCTCCCCCTAGGGCCGTGTGGCCTT
CCGCCTTCCTTGTCTTGGTGTTGTACCGCGAACAGCCCAGCACAACGGCGTGCTTGAACTCCAGCTCCGGGTGGTCGTCCAGCCCGGCCGCTTCAATGTC
CCGTTCCACGAGTTTGATGAGCTTTTGGCCGTAACGGACCGCGCGTGGGCGTTCGTGAAGCTGCACCGCAGCAGCTGCACGTCGGGCAGTCCGTGGCTGC
AAACTGCATGGCGAACGTCTCTCTGGGCAAACCTGCAGCGTGCAAGAGCTCTGCAGTCGCCATTTGGAGCAGCAATGCGTTGAATCGCACTTTGGCGATT
GCTGCAGCGTCGGAATTGTCGACGTTAGGGGGAGCGTCGAACCCGTCGCGGATTCCGGAATCCGAGCACGTTTGGTAGTGGAATTTGACCACGTAGCGGG
TGGTTGGCGGGCGGTACTCAATGCAAAAGATGCGCTCGATGGCCCCGGGGGCGCGCAGTGTGATAGCGAACTTGCCGGGGCTCGGGAGCAGCACGAACGC
CTTGAAGTGGCCGCTGGAGGACGAAATCGGCCATAGCGAAGAGCGGAGCGCGTCCAGACGAGCTTCGAGGAAGAGTGTCTCGGTGGGGTGGACGTTGCGG
ACGTGGCCTTCCAGGAGGACCAACGGGTACGAGAGAACTTCGTCCTCCAGGAGGTTGTCTACGGCGATGGAGGACATCGACGGAGAAGTCTGATTTTTGA
CAAGGCTGAGAAGAATTGTATTTTTTTACATGGCTACAAACGCATACTTGATATTTGTATGACGAATCCACTTTGTGATGGAGTGAATGTCTCCCAATGT
GGTGGCATATTTCCTCGATGACGGCCTGCCAAGCTGACGGTCGCGGGTGCCAGACTTGCACCGGGACGAGCGCACAATACGGACTCGTCGAGGCACTGCT
AGCGAGCAATAG