Description :
From Genome Similarity Track
Location :
Scaffold_164:10504- 14294
Transcript NameFunction/comments
Physo_144048reverse transcriptase

Sequence
3790 bases(100 bases per row)
CGGGTCAAGATCGCCGTCGGCGTTGTGTACTGCGGCCGCTCCACAGCAGACCCCTGCACGTCGGCGGGCTCAGGCACGTCCTTGGTAGCATCGGTGGTTG
CTTGGTACGCGAAGTTCCGCCACTCCGCGTACCTGCGAGATCCAACGGAGACATACCCAGGTAAGCGCGGCACTCGATCTCCGGCCAGCCACATCGCGAG
TCGCGTACCCTGATGCAGCACTAACTCGCGATCGCTCACGTTTGTCAGTTGCAGGTAGCGGATCTTGCCCGATCCACCAGTCACGGTAGGCACCCACCGA
TCGCCGCGCGTAACCCAGAGTTTCTGATGCTCTGTTGATCTTGTGCGCCGCTTCACCTCAACGGTTCCCGCTATGTCGATCTCGCGGTAACCGGTCAAGG
TCACCTGCTCCACCTTGTCTCCGTAGAGCGGACGTCTCCCAGCGAGCTGGATCCGCACTTCGTCAGGCAGGCAGATTGTCCCGTCGGCAAGATCGAGGCG
GATACCCGCCGGTACCATGAAGTCCATGCCGATGATTAAGTCCTGACCGCCGGTCGGCGGACCCACCCAATCATCGAAAAAATACACAAGTGATCCAGCG
AGCGTGATCTTGACCCGTGCACGTCCTTCCGCCATGTATGGAGATTTTCCGACGCCTTCGCACTCCAATGTCTGACTTTCGTCAATGTAGCACCCCACCT
TACGAGAAAAGGCGGTGTCTAGGATAGACACTTCGGCACCACTGTCAAACAACAGAGTAGCTTTTTCGTTGTTGATCTTTCCTACAGCTTTCGCTTGCTT
GAACTTCTTGTCAGGCACATGGTATTTCCAGTAACCACGCGACTCCCCCAACGCAATATCCAAAGCCATCTTCACGCTCGATCTTGAGTAGTCATCAACT
TGGTGAAGACTTGACATGGCAGCCGTAGGTTTCTTTTGAAGATACCATGTATTGTCGATGGGTTTGCTTACAGTCGACTGCGACTGCTTCTCGACATACG
CAAAGATGCAGAACTGAGAACGCTCGTCTCGTACCGGATTCCAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCCGCGGACTCGGGCAACATGCCCCCG
TGCTTGGTGGGATTGTACCACTGGCGGATCAAATTGTAAAATTCCTCCATCGGACAGCTTCCTTCGTCGTGGATTTTGCCGCAGGCCTTGCAGACAAAGA
GACAGCGATCTGACGGGTGACCATGCTTGCCACATTTTTCACACGTCAGCTGCTTCCAGCATCCCAGATCGTCGTGTTTGGTAGACCCGCAATGAGTGCA
CCGCTTGAGGGGCGGCCCCATGTCGATCGATTTAGAGAGATGTCCCGGTCGACGATCTTGACGGCCTCGATCTTGATCCGGTGGACGCCGATCTCGGCCG
GCCGAGCGATGTTCAGTCGTTCCATGATCGTTACTGGCTGAAGTCGCGTACACTCGGCGCAGATCTCCCTCTTCATCCGAGTCGCTGGATCCTGCATCCA
AGTCACTGCTGTCGCTCTGCACCTGAATCGCTCGTACCGCGCGAGCACCGGCGGCGGCTTGCGGCTTCGGGCGGGGCTCAATCGAGCCGTACACCGTCTT
GCTCTGTCGCGCTTCGGCACGCTGGCGAGATCGCAAAACTTCTTCCAGAGTGTCCGCGTCGGGAATCCGAAGCAGGGCAAGCTGGTCCGCTAGATCGCGA
TCATCCAAAGTCTCGATAAAGTGTTCCACATGTTCCCGGCGCACGTCCGGCGGTCCGTCCTTGACTTGTAGACGTGTCCGCAGGCCTGCGACGTTGAACC
TGTGGAGGTACTCCAGAGGCGACTCGTCAGATCGTTTCCGAGCATGGTAGTACTGGCGGGCAACCGAGACACCACGCCCACAATACTGGACCTGGAAACT
CTGGAGCAGGTCTTTCCACGTGGTACGAGTTGTTCGGCTCAGCTGCCTATACCAGTTTCGCGCTGGACCAGTGAGCAAATCACCGAACGCCAGACACTTC
TCATCATCAGGCGCTTGATCGCGGACGAAAGCCGATCTTACCTTGCTGACCCAAGATCGAGCTCGATCTTCGTCGCCGTCCTTTCCGGAAAACTCCTTCA
GTTCCGACATTGCACACACACGAATGCGTGGTGCGGTCCCAGTTCCTCCAGGCGAAGCAGTAGCCGTTGTTGCTACCGCCGCGCGGATAGGCCAACTGAG
ATCGAGGTCGTCAGGATCAAACTCCCCTGACGCAGAGTGTCGGTTTGGTGATCCAACCGACTCCATCTCGACATCTTGATCTTCGGTCGGTCGCGACTTC
AGCGCGACACCAAGTAGCTGCTGCTCCTTCAGAAAACGTTCCATGGCCGCTTGGAAGAACGACTCGAGTCTTTCCGGGGAGTGTCGCACTGAAGTTGCTA
CGCCCTTCGGCTCTCGCGTTGGCACAACCACCTCACGCTCAGCACGTTCAGCTCGACTTCTTAACATAGCGGCACCGGAAGGGTCTAGCGTCATGCGCGG
TGGCGGATCATCGACACTGTCAGATTCCACGTCTTCTGTTGCAGACACGTACGGAGATGACGTCGGAGTTTGGCCACCCGGATTGGGCGCAGGCGTCGAT
CTGGCGGGTGTCGATCTCGATAGCGTCTGGGGCGATCTTGATGTTTCTTTCAAGGATCGACTCGACTCACCGACCAACGGCTTCAGTAGCAGGAACAGCC
TCTGGGCCGAGTTCTGGATCGTACTGAGCTTCAGATGGAACAGGCTTTCCACATCCAGCACTCCTGCGATGATACCAACTTCCTTGAAGAGCCGTAGCAG
CGTCTGAACGGCATCCAACTTGTCCGATCCAGGGGGCGGCTGTGACACCGGTCCCGCAAGATCGCCGAGGAGCTTTGGCCGGAGGAGCTTCATCACATCG
TCCTGAAGCAGGAAAGCGTACAGCTCCTTCTTGTAGTACGTTACAGCGAGTTGATCCTCAGCCACGGTCAGTGTGAGATCGGCTCGATCCTCAGCATCGG
AGTCTGGAGCCTTCATCTTCTTCCGCGACGACTTCGATATTGCTGGCTTCTTCTTGGCCGATCTAGCGCTGGGTGGTTGGGTTCCGGCTTGCGCCGGTGG
ACTTTCGTCCGGCAGGCCACGATTCGCCTCGTGCCCTGCGGGGGTCCCCGAGGAGACCTGGGGAGGAGGTTGAGGCTTTTCTTCCAGGTCCGTTGCCGGG
CCTTCCTCTGTTCCGTCGGTAGAGCTTCTCCCTAGACTCTGCCGATCCGCGGATCGATCATGTTTCAGCGGCGTCGACGCCGATCCGATCTCTGTAGACG
CTTCATTCCCTTGTCCAAACTCGGCTTGCGCATACTCTTGGAGGGACTCACGGTGAAATCCCGAGTCACTCAAAGATCCGGGAACGCGCACCACTGTGGC
GAAGGGGATCCGCGAAATTTGCAGATCGCGGGGGTCCTCTTGCACACGGCGCCCGAACTGCCGACTAACGGAGGGGGTACTCCGATCTCCCGTGAAGTTG
CTGATCCTCACCTTGTGTACCCGTCGGTGGGCTGGATCGCTCTTCGGGTGATCTCGAGAAGACGCGCTTGGGGTTGAGTCTTGGACTGTCTGGTGGACAG
CGGGAACTTGTGGCAGCAACGCGGATATGCTTCACGCTGTGCCGGAGTAGTTGTGGCGGTTTCGGTCTGGGGTTGTCTAGATCGACAGGTGTGATCTTGG
CCTGGGGTTGCCTTGTGGTCGGTGTGTGACCTTCCTTTCCTTTCCTTGCTTGCCGCTTCCTCTAGCGGTGGGTCGAAGTGAGGGTTGACG