Description :
From Genome Similarity Track
Location :
Scaffold_802:10504- 13027
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_802-snap-gene-0.6Conserved gene of unknown function

Sequence
2523 bases(100 bases per row)
TACAGGCGCTGTTCGCGGAGAAAGCGCTCTATTGCCTGTGCCACTGCAATCGTGACTCCATCACAGTTTTTCATGGCGTACTCCGTGAAGTTCGCGGCGG
CAGATGTGAGGGTTTCCCAGTCCGTGGGCACTTGAGCCGGATCCAGCGCCACCGAGGCTGAGTAGTCGAGTGTGTTGGTGGAGTCGCCTTTTTCACGTGC
CGCCATGTCGTCACGATACGTGAAAGTGCGGAAGTGCATGAGTGACAACCCTcTTGCACCGAAGCCCAAGTCGTAAACGCATGTCAACACCGCTGGTACT
CGTTGGAAaCgTaGCTCCTCGTCGGCGGATATCAGCGTACAGTATtCCATGGGATTCGTACCTTGGAGACGCTGGTTCGTCACGAGCTCGTGTGCCTTGA
TCCGTGAGTTATGAGGGCGAAAATCGGTTCGACTTAGCTTGGACGTTGCTCCGGACGATGTCTCCGCGTTAGCAGCAAAGTAGGCGCGAAGAAGAGCTGG
ATCACGATTCATCGCTGCTAGTTTCTCTCGTTCTGTATTGGAGTCGAAACCACCAGGGgCAAACTGACCTTACTGGAAACAGCCTGGTCTTGCAATTCGC
CGAAGAAGTTtATCTGGTCACCTTCCTCTTTTGACTCGTCGGCCAAACGTGCCCTCTTAATCGATTCGTCATATCCACAACGCTCGGCTGTGATGAAGCT
CAGAGCACGTTTTCCGCGCATAGGCAAACCTTCCCCACTCAAGGAACCTGGGTCCTCACCAATTGAGTGTCCGATCACCATTCGAGCCGCCAAGTCCGCC
GGTCGTCCACTTCGCTCGAAATAGGTGAACCGAATTGCGTGGTCTATGGTGGTATAGTTGGCCACTCCCGTCATTTTATTGACCCACTGAACCACCGTGT
TTTTCGAAAGGATTTGGCCGCCGCGTGTGTTGGACATGATCGTCTCCAGAGATGGTGGCGTGTCCATGTCTCGATCTGTGATCTCGTCAAAGGCCGTGTT
CACACCAGCAACAGCATTCTCGACGTCCTCCACGCTCCAGCTGGCCACCGCTTCAGGCTGTCGTGCCATTAGAATTGCCAGCACATCCGGTACAATCATC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCGGCTCGCGTTCGCGAAAGGGTTAATGTCCTTGATTTTCACTTCCGTGGGCGTTCGTGCTCCTTTGAGATACACGCTAGTTCCGTCAACGGAT
ATGATTTGTCCCATGACCATGACACCGTGTGCTACTCCGGCGATGGCCATACGCATCATGCGACCTGGAGCCGAAATTGCTTCTTCCTTCGACACCTTAC
GCTGCTCTGCCAGCACCGTCTACACTTGGAGCACAAGGTCACCTTCGACTTCGTCGTCTTCCACTGGTCGTGTGATAGTAACGTTCATGGCACTCGCACA
ATACCGTCACATACGTGCATTCACCGATACGGCCGTGCACGTCTTCTGGATAGAGAAGCAAGTAGTCATTGGTGTTCAAAGGCATAGTGATCGTGGACTT
GTAACTCTTGGCTTGACTTGGTTGCTTTCGTTTCTAACACGTGGATGTTAGAAGGCTTGTCGCTCAGACGAATCTttGAGGAATGAGAGCTAGAGTTGTG
GACTTACGCGTAAAGGTGGAGGGCCTGTCGCGGAGAAGGCCCTCCcAAGTTGGCCGCCGTCATCACCGGGCGGCGTGGCTTGAAGTCAGCGAGCATGATT
GGCGCCATTGCTGCCGCGCCGCGGAACCTTCGACCGCATGCTCCCTcGCCCCCTGTCGACTACGTGCTGGAGCTGGTGTGCTTGCTCACGTCGCTTGCGG
TGCGATGAGTCGTTGAGAGAGTGCGTTCCCGTCACTGGAAAACAGGTTTCCCACCGGTTCTCTGTCAGGAAACCCTGAGCCCCAAGAGCACAGTGTAGCA
GTGTGTGAAGACTGCATCTGATT