Description :
From Genome Similarity Track
Location :
Scaffold_192:10504- 12645
Sequence
2141 bases(100 bases per row)
TGCTTCTTCCTCTTGGGCTCAATCACACTCGAATAGCGCAACTCACGAGCCAAACGGAGGGCTCACGGGAAGAGGGGAGCGAGAAGCTCCAATTAGGGAC
ATTCGGGATATTTTAACAGCCATTTTTGCGCTCAATTCGTTGTTGCAACCTAGGAATTAGAGCAGCAGATTGGTTAAAAACTTCCTTGATAAAACAAAAG
GCGGCTTGAAAGGCTGCACAACGCACGCCATGATGGCGATTCGCAGACTTGTCTCGTGAGAAGCGAGCGCACTAGATGGACACAAAATTTATTACACGCA
CGTACATACTCTTTGCCGACGGGCTTATTTGCTGGAGGAGTTGGTGAGAGACTGGGAAAAAGTCTTCGCCCGAACGGTTCACCCGATTGAAGACTCGCCG
AGACACAAGTCATCTGATCCAGAAGATCTCACGATCTAGATCTGCCCTTCCATCAGTTCTGGATTAAAAGAAAATAACAACACCATTTGTTAGTCTCGAT
GGCTCTCTCTTGCAGCAGATCTAGACGAAGCGGCGAGCATACCAATCGATTCACGTCCTGGGCTCTGCACTTTCGACTCCCTGTTCAAATCACAAATTGC
AGATTAGCACAACAAATTTAACGTGGGCAAGAACAGTGTCGCCTTCATGACGATCCACTTACTTTCGAGCTCGCTGGGCAGCTTCCTTCTTCGCCTTCAG
TGACTCGATCGTTGGCCGGTCCCATTGCGTGAGCTTCAACGCAGGGTTGCAAAAGTAAACTTTGCCCTTGGAGCGGGAGAGGCGCGCTTCCCAGCCTGGC
GGCAACGGCGTCCCGGGCATCGCGTCGAGATTGAAAGCCTCGTTAAGATTTCCCTCGGACGGACGACCAAACGGGTCCGACATCCCATCGCCGTAGTATT
TGCCCTTCACAGCAGTGATCTTGCCCTTCAGGGTCGTCATCGCGCCAACTCCAGCCGCGCCAACACCTTGGAGAAGGGACAGACGGCCACCACCTTCAGC
TGGATCACCACCCGACAAGCGCTCTCCACCATCGTCACCACTGCTACCCCAGAACTTGGTGCGAGACATGCGTTGAGCTGAAGCTTTCAAGAACTGCGCA
GTGTCCGCTGACTTTTGCGCGAGTGATGCGTGCACAGCCACCGAGCCTCGATCGTAGTCGCCGTACAACGACTCTCTCGATCCATTCCCACTGTCTTTCT
TCGAGCCGAGCGTTCGGAAAAGTGACTTTCGTTCTTTTCCCATTGATTTTTGCCTGTCCAAGGAATGGGTACTCGATATGCTTGCTAGCTCGCGCAGTTT
GTGGCACTCTTTCTCGGCAGCAGCGAGCTTCTTGTCTTTTTCTCGTACCTGCAACAAATAGCCACCAATTTGTATTAGCAAACCTCGAGCAACATCACAA
TCATAGGCATTAGCATCCTTACCGTGTCTTCGAACTGTCGAATCTTGACGTGGTAGTTTGCAGCAAGAACTTCTTTCTCGTTCTTCAGCTTCTCCAGTTC
GTTCTTCAAGGCGTAGCTTTGGCTTCGTTGCTCTTCATTCTCGCGACGTAGGCGAGTTGCTTCAGCGTTCAGTTGGCCAAGGATATCATCTGCATCAGCC
ATCCAGAGATGGGCAGTTGATTTCCCACGCGATCTTGCTCCTTCCGTCTCAGTGAACAAGATGCTTTCGCGTGTGTTGGAGTCCCGTTCCAGCTTGAGCT
CAGCATTGCGTCGCTGCTCGTCGTGAAGTCGAGACTGGAGGCTCTGCAGCTGGGAGTTCATGTTGTCTTGCACCTTCTTCTCCGTGAGCAAAACTCGGAA
CTTCGCTCGCTGGTTTTTCATACGAACAAAGGCTTGAATTTTCATCACGCTCTTTCGAACCTCCTTGAATTGTTTTCTGTAAAATAACACAAACAAGAAT
CGATCAAGTGTGAGTAAGCGTTCATCCGGACAGGACCGGTGTCTCAATACACAGCGAGTACTTACCGCTTGACGAAACCGCGAAGATGACGCTGGATCGT
GATAACACTCTTGGTTTTATTGACGGCGACAGCGATGCGACGACCTTGGTATCCACGCCAGTGAGCTTGCAGGGTCGTCAGTGCGTGCTTAAATGAATGG
TATCGGTTCATCATTATCACACAGCGCGCGACGGACTAATT