Description :
From Genome Similarity Track
Location :
Scaffold_18:105010- 107277
Transcript NameFunction/comments
Physo_131910hypothetical protein

Sequence
2267 bases(100 bases per row)
TCTCAGCCTGCTCCCGACAACTCGCGCGGTCGTGGTCAAGTTATGCGTCGCGACGCCCTGGAGCAGCTGGTCCGTGATGCATGTGATGAGTCGTCGGAGC
GCATCTTGGCGGTGCTGGGCTCGAAGCTGGAGTCTCTCGGCCGTCTCTCGGTGAACCTGCAGCTGGGACCGAGCATCCGTGGTGATCGCCGCGTGGGTTC
TCGCCTGGCGTCGGCCCGGAACCTCGATGAAGTGGTTACTGCTGCGGAGCCAAACATGGATGTTGGCGAAGGCTCGACGCTGGACATGGCAACTATGCGC
GCCCGGCTGCACTCTGCTGAGTCAGCGGAGGCTGCTGCAGAGAATCGGTTGCGGTCGCAGACGTACTCTTTGGAGAACCAGAAGGTATTCTTGAAGAACG
CAAACGACGGGATCGCACAGCTGAAGAAGGATGTCGCGCATCTTCGTCAGCTGGAGGTTCATTACATCGTCGAGCTCGAGTCGTCGAACGCCGCCGTGGA
TGGCCTCAGAGAGTGTTCCGAGCGGCAGGAGAATCGTGTCAGGGTGGCCGAAGACTCACAAGCCCGGGCTCTAGCTCAGTTGAAACGTGAGCAGGAGGTC
TACAAGGCGGCCGTTGCTTCGTCGACTGCTCAAAGCAGGCGCTTGCACAATCTGCTGGCTCGCTCAGACGCCGCCGATGACACCGCACCAGCTCGCCATC
GCCGCCGCAATGAGGACCTCGAAGAGCAAGTGAAGCGGCTCCCCCGTGCCAACAAGACGTTTCGCGCTCACGTGCAGCTGGAAGATATGGACCCCGACGT
CCTGGTCCTCGCCGTAGAAGGTTCGTAGTCTCCATTTGGTCGTCATTTGGTTTATGTTTGCTGGCTTTGTCCCGATGACACATCTTGCTTGCAGGTATCT
CGACTGGTGAACTCAATTGGAGCTTGCTGGATCTTACTCCCGAGTCTCTCGCGATTTTGCAGAAGCAGTATCGTACAGCAGACTGCTCCAAGCCGGACAG
AGATATCGCCGAAGACTTGGCTCGGACTGCCTTCTCACTGAATGACTCCATCGGGGATCCCTTGCGCAAGGACACTCTCGCTGGTGCAAACAAGACCACT
CCGGGGACGTCTGCCACTGCAGTCAAGAAATCTCGCGCGTCGCGTCGGTCATCGTCTTCTCCACGGTTCTCGTCCCGCAAAAGGTCTCGCGAAGACTCGG
GCTACGTCAGTGCTGCTGCTTCCCCAGCTCGACCGAGTCGCTCAGGGTCGAAGGCTCGCAAGACTTCTGCCGAGTCATCGGCTGGGTCATCGGTGTCATC
GTCTCCCGTGATGAAGTCGTCGGAGAAGCCCAAGAAGTTGCCCAAGAAGCGGAAGGAGTCTCGCTGGGCACGAAGTCGTTCTGCGTCGGTGCCTCGCGGC
TCTCCGGGCTACGGCGCTTCATCGGTTCCAGTGTCTCTCCGCCCACGAGTCCTGCTCCAGTCGCGAAGGCTACTGCGCCCTCTGTTCCTGGTTCTGCGCC
GCCTGCTGCTTCTGCGGAAACTCCTGTCCAAGCTGTTGTCCCAGTCTCTGGTTCCGGTGATGATCCACAAGTTGGTGGCTTGAGTCATCGGGCTGATCGC
GGAGGGACGGACGAGCAGTTAGCTTCAGTCGAGCAGTCTCCGGAGGTGCCTCAGTGGTTCGGAGATGGCTCGGATGCTGGATTGACGGAGGGTCTGGTTG
ACGACTCAGTGGTTGATGGCGGTGCTGCTTCTGCTGATGAGGAGGAACTCGACGAGTGGGAGGGAGAGCGCGTTGTGGTGGTTGCTGTAGTTCCAGCTCC
GTCACCTCCGGTTGCTGACGGTCTGTCGTCATCGGCTTCCACTGATCTCTCGTCACCTGCGCCAGCTCTGCCTCCTGCCAGCGCTGAGTCATCGACTTCT
CGTCCGCTTGGTCCTGCAGCTTCTGCTGAGTCGGCGGACACCTCGGTCGCTGTCTCATCGGCTCACCGGCCTGCAAATGCGGCATCTCAGTAGGTTCCGA
CGACTCGTGCCCGAGGTAAGAAACCGGCTAAGTCTCGCCATAAGTTGTCATCGCGCCAAGTCGTCACTACGCAGTTATCGGCCCAGGACCAAGTTCAAGT
TCTGCGCGCTCTCTGTGTGCCTCGCCTGCAGCCCGAGATGTGCTGCCCACTGCTCGTTACTCAAAACACGTGTTGAACTGGGCCACTCCATACTTGGCTC
CTGAATTCCGGTTTCCTGGCGCTTCTAAGTGCTGGATCCAGATTTTGAATTGCGAGTTGCCGACTCC